EMAIL THIS PAGE TO A FRIEND

TFEB

transcription factor EB

Synonyms: ALPHATFEB BHLHE35 TCFEB
UniProtKB ID: P19484, Q709B3, Q7Z6P9, Q9BRJ5, Q9UJD8
Gene ID:
Mouse(21425) transcription factor EB
Rat(316214) transcription factor EB
Zebrafish(562289) transcription factor EB
dog(609046) transcription factor EB
chicken(419922) transcription factor EB
Horse(100066433) transcription factor EB
domestic cat(101099802) transcription factor EB
cow(510032) transcription factor EB
sheep(101109048) transcription factor EB
Goat(100861000) transcription factor EB
naked mole-rat(101713925) transcription factor EB
Domestic Rabbit(100328714) transcription factor EB
domestic guinea pig(100719617) transcription factor EB
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108453 Anti-TFEB affinity isolated antibody horse, human, mouse, guinea pig, goat, rat, canine, pig, rabbit, bovine
western blot pricing
AV100809 Anti-TFEB (AB1) antibody produced in rabbit affinity isolated antibody human, goat, canine, guinea pig, mouse, rabbit, rabbit, bovine, horse, pig, rat
western blot pricing
SAB2501030 Anti-TFEB (Internal) antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, human, rat, canine
ELISA, western blot pricing
SAB2106184 Anti-TFEB antibody produced in rabbit affinity isolated antibody horse, human, rabbit
western blot pricing
SAB3501044 Anti-TFEB antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, immunohistochemistry pricing
HPA049532 Anti-TFEB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB2501031 Anti-TFEB, N-Terminal antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ChIP, ELISA, immunohistochemistry, western blot pricing
SAB4503154 Anti-TFEB, N-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing
SAB1412762 Monoclonal Anti-TFEB antibody produced in mouse clone S2, purified immunoglobulin, 0.5 mg/mL human
ELISA, western blot pricing
SAB1412763 Monoclonal Anti-TFEB antibody produced in mouse clone S3, purified immunoglobulin, 0.5 mg/mL human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007162 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007162 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007162 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011549 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011549 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011549 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU059261 MISSION® esiRNA esiRNA human TFEB (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007162 Rosetta Predictions human pricing
NM_001025707 Rosetta Predictions rat pricing
NM_011549 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007162 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058321 predicted 1057
2 SASI_Hs01_00058322 predicted 1053
3 SASI_Hs01_00058323 predicted 1799
4 SASI_Hs01_00058324 predicted 1602
5 SASI_Hs01_00058325 predicted 2103
6 SASI_Hs01_00058326 predicted 781
7 SASI_Hs01_00058327 predicted 1999
8 SASI_Hs01_00058328 predicted 1038
9 SASI_Hs01_00058330 predicted 2032
10 SASI_Hs02_00343094 predicted 696
11 SASI_Hs01_00058329 predicted 825
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025707 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063597 predicted 1532
2 SASI_Rn01_00063599 predicted 669
3 SASI_Rn01_00063600 predicted 1734
4 SASI_Rn02_00203325 predicted 933
5 SASI_Rn01_00063601 predicted 1244
6 SASI_Rn01_00063604 predicted 998
7 SASI_Rn01_00063605 predicted 628
8 SASI_Rn02_00203326 predicted 1075
9 SASI_Rn02_00203327 predicted 1280
10 SASI_Rn02_00203328 predicted 1001
11 SASI_Rn01_00063596 predicted 1977
12 SASI_Rn01_00063598 predicted 948
13 SASI_Rn01_00063602 predicted 1980
14 SASI_Rn01_00063603 predicted 988
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011549 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082195 predicted 1517
2 SASI_Mm01_00082196 predicted 660
3 SASI_Mm02_00320900 predicted 757
4 SASI_Mm01_00082197 predicted 992
5 SASI_Mm01_00082198 predicted 960
6 SASI_Mm01_00082199 predicted 1396
7 SASI_Mm01_00082200 predicted 1890
8 SASI_Mm01_00082201 predicted 794
9 SASI_Mm01_00082202 predicted 971
10 SASI_Mm01_00082203 predicted 993
11 SASI_Mm01_00082204 predicted 896
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007162
TFEB MISSION shRNA Bacterial Glycerol Stock
transcription factor EB
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000440038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007162.2-707s21c1
Sequence:CCGGTGGCAACAGTGCTCCCAATAGCTCGAGCTATTGGGAGCACTGTTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007162.2-766s21c1
Sequence:CCGGGGGAGTTGGATGATGTCATTGCTCGAGCAATGACATCATCCAACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007162.2-583s21c1
Sequence:CCGGAGTACCTGTCCGAGACCTATGCTCGAGCATAGGTCTCGGACAGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007162.2-1146s21c1
Sequence:CCGGGTGGATTACATCCGGAGGATGCTCGAGCATCCTCCGGATGTAATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007162.1-2220s1c1
Sequence:CCGGCCCACTTTGGTGCTAATAGCTCTCGAGAGCTATTAGCACCAAAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007162.1-1037s1c1
Sequence:CCGGGAGACGAAGGTTCAACATCAACTCGAGTTGATGTTGAACCTTCGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007162.1-605s1c1
Sequence:CCGGGAACAAGTTTGCTGCCCACATCTCGAGATGTGGGCAGCAAACTTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007162.1-806s1c1
Sequence:CCGGCGATGTCCTTGGCTACATCAACTCGAGTTGATGTAGCCAAGGACATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007162
TFEB MISSION shRNA shRNA Plasmid DNA
transcription factor EB
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000440038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007162.2-707s21c1
Sequence:CCGGTGGCAACAGTGCTCCCAATAGCTCGAGCTATTGGGAGCACTGTTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007162.2-766s21c1
Sequence:CCGGGGGAGTTGGATGATGTCATTGCTCGAGCAATGACATCATCCAACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007162.2-583s21c1
Sequence:CCGGAGTACCTGTCCGAGACCTATGCTCGAGCATAGGTCTCGGACAGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007162.2-1146s21c1
Sequence:CCGGGTGGATTACATCCGGAGGATGCTCGAGCATCCTCCGGATGTAATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007162.1-2220s1c1
Sequence:CCGGCCCACTTTGGTGCTAATAGCTCTCGAGAGCTATTAGCACCAAAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007162.1-1037s1c1
Sequence:CCGGGAGACGAAGGTTCAACATCAACTCGAGTTGATGTTGAACCTTCGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007162.1-605s1c1
Sequence:CCGGGAACAAGTTTGCTGCCCACATCTCGAGATGTGGGCAGCAAACTTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007162.1-806s1c1
Sequence:CCGGCGATGTCCTTGGCTACATCAACTCGAGTTGATGTAGCCAAGGACATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007162
TFEB MISSION shRNA Lentiviral Transduction Particles
transcription factor EB
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000440038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007162.2-707s21c1
Sequence:CCGGTGGCAACAGTGCTCCCAATAGCTCGAGCTATTGGGAGCACTGTTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007162.2-766s21c1
Sequence:CCGGGGGAGTTGGATGATGTCATTGCTCGAGCAATGACATCATCCAACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007162.2-583s21c1
Sequence:CCGGAGTACCTGTCCGAGACCTATGCTCGAGCATAGGTCTCGGACAGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007162.2-1146s21c1
Sequence:CCGGGTGGATTACATCCGGAGGATGCTCGAGCATCCTCCGGATGTAATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007162.1-2220s1c1
Sequence:CCGGCCCACTTTGGTGCTAATAGCTCTCGAGAGCTATTAGCACCAAAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007162.1-1037s1c1
Sequence:CCGGGAGACGAAGGTTCAACATCAACTCGAGTTGATGTTGAACCTTCGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007162.1-605s1c1
Sequence:CCGGGAACAAGTTTGCTGCCCACATCTCGAGATGTGGGCAGCAAACTTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007162.1-806s1c1
Sequence:CCGGCGATGTCCTTGGCTACATCAACTCGAGTTGATGTAGCCAAGGACATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011549
VALIDATED
TFEB MISSION shRNA Bacterial Glycerol Stock
transcription factor EB
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011549.3-977s21c1
Sequence:CCGGGACGCAGGTTCAACATCAATGCTCGAGCATTGATGTTGAACCTGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011549.3-533s21c1
Sequence:CCGGAGACCTATGGGAACAAGTTTGCTCGAGCAAACTTGTTCCCATAGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085548    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011549.2-1894s1c1
Sequence:CCGGCGGCAGTACTATGACTATGATCTCGAGATCATAGTCATAGTACTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011549.2-177s1c1
Sequence:CCGGCGAAGATGATGAATACTTCATCTCGAGATGAAGTATTCATCATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011549.2-163s1c1
Sequence:CCGGGTGCTTAAAGACTACGAAGATCTCGAGATCTTCGTAGTCTTTAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011549.2-324s1c1
Sequence:CCGGGCAGGCTGTCATGCATTATATCTCGAGATATAATGCATGACAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011549.2-1526s1c1
Sequence:CCGGCCAAGAAGGATCTGGACTTAACTCGAGTTAAGTCCAGATCCTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011549
VALIDATED
TFEB MISSION shRNA shRNA Plasmid DNA
transcription factor EB
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011549.3-977s21c1
Sequence:CCGGGACGCAGGTTCAACATCAATGCTCGAGCATTGATGTTGAACCTGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011549.3-533s21c1
Sequence:CCGGAGACCTATGGGAACAAGTTTGCTCGAGCAAACTTGTTCCCATAGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085548    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011549.2-1894s1c1
Sequence:CCGGCGGCAGTACTATGACTATGATCTCGAGATCATAGTCATAGTACTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011549.2-177s1c1
Sequence:CCGGCGAAGATGATGAATACTTCATCTCGAGATGAAGTATTCATCATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011549.2-163s1c1
Sequence:CCGGGTGCTTAAAGACTACGAAGATCTCGAGATCTTCGTAGTCTTTAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011549.2-324s1c1
Sequence:CCGGGCAGGCTGTCATGCATTATATCTCGAGATATAATGCATGACAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011549.2-1526s1c1
Sequence:CCGGCCAAGAAGGATCTGGACTTAACTCGAGTTAAGTCCAGATCCTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011549
VALIDATED
TFEB MISSION shRNA Lentiviral Transduction Particles
transcription factor EB
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011549.3-977s21c1
Sequence:CCGGGACGCAGGTTCAACATCAATGCTCGAGCATTGATGTTGAACCTGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011549.3-533s21c1
Sequence:CCGGAGACCTATGGGAACAAGTTTGCTCGAGCAAACTTGTTCCCATAGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085548    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011549.2-1894s1c1
Sequence:CCGGCGGCAGTACTATGACTATGATCTCGAGATCATAGTCATAGTACTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011549.2-177s1c1
Sequence:CCGGCGAAGATGATGAATACTTCATCTCGAGATGAAGTATTCATCATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011549.2-163s1c1
Sequence:CCGGGTGCTTAAAGACTACGAAGATCTCGAGATCTTCGTAGTCTTTAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011549.2-324s1c1
Sequence:CCGGGCAGGCTGTCATGCATTATATCTCGAGATATAATGCATGACAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011549.2-1526s1c1
Sequence:CCGGCCAAGAAGGATCTGGACTTAACTCGAGTTAAGTCCAGATCCTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks