EMAIL THIS PAGE TO A FRIEND

TFEC

transcription factor EC

Synonyms: TCFEC TFE-C TFEC-L TFECL bHLHe34 hTFEC-L
UniProtKB ID: O14948, B2R8X5, Q5H9U8, Q709A4, Q8N6J9
Gene ID:
Human(22797) Summary: This gene encodes a member of the micropthalmia (MiT) family of basic helix-loop-helix leucine zipper transcription factors. MiT transcription factors regulate the expression of target genes by binding to E-box recognition sequences as homo- or heterodimers, and play roles in multiple cellular processes including survival, growth and differentiation. The encoded protein is a transcriptional activator of the nonmuscle myosin II heavy chain-A gene, and may also co-regulate target genes in osteoclasts as a heterodimer with micropthalmia-associated transcription factor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
Mouse(21426) transcription factor EC
Rat(26296) transcription factor EC
domestic guinea pig(100717764) transcription factor EC
naked mole-rat(101697964) transcription factor EC
cow(539016) transcription factor EC
sheep(101109437) transcription factor EC
Zebrafish(556894) transcription factor EC
chicken(417773) transcription factor EC
dog(475292) transcription factor EC
domestic cat(101085109) transcription factor EC
171 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012252 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012252 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012252 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031198 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031198 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031198 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU066721 MISSION® esiRNA esiRNA human TFEC (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001018058 Rosetta Predictions human pricing
NM_012252 Rosetta Predictions human pricing
NM_022379 Rosetta Predictions rat pricing
XM_342644 Rosetta Predictions rat pricing
NM_031198 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018058 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035416 predicted 1436
2 SASI_Hs01_00035418 predicted 1505
3 SASI_Hs01_00035419 predicted 799
4 SASI_Hs01_00035420 predicted 862
5 SASI_Hs01_00035421 predicted 1555
6 SASI_Hs01_00035422 predicted 1466
7 SASI_Hs01_00035423 predicted 1596
8 SASI_Hs01_00035424 predicted 1519
9 SASI_Hs02_00306947 predicted 1481
10 SASI_Hs02_00306948 predicted 812
11 SASI_Hs01_00035415 predicted 591
12 SASI_Hs01_00035417 predicted 978
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012252 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167419 predicted 1530
2 SASI_Hs01_00167421 predicted 1588
3 SASI_Hs01_00167422 predicted 886
4 SASI_Hs01_00167423 predicted 945
5 SASI_Hs01_00167424 predicted 1645
6 SASI_Hs01_00167425 predicted 1554
7 SASI_Hs01_00167426 predicted 1691
8 SASI_Hs01_00167427 predicted 1603
9 SASI_Hs02_00343960 predicted 1571
10 SASI_Hs02_00343961 predicted 899
11 SASI_Hs01_00167418 predicted 673
12 SASI_Hs01_00167420 predicted 1065
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022379 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263131 predicted 605
2 SASI_Rn02_00263132 predicted 1254
3 SASI_Rn02_00263133 predicted 744
4 SASI_Rn02_00263134 predicted 433
5 SASI_Rn02_00263135 predicted 1025
6 SASI_Rn02_00263136 predicted 1242
7 SASI_Rn02_00263137 predicted 996
8 SASI_Rn02_00263138 predicted 845
9 SASI_Rn02_00263139 predicted 503
10 SASI_Rn02_00263140 predicted 463
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342644 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00132650 predicted 430
2 SASI_Rn01_00132651 predicted 443
3 SASI_Rn01_00132652 predicted 438
4 SASI_Rn01_00132653 predicted 457
5 SASI_Rn01_00132654 predicted 511
6 SASI_Rn01_00132655 predicted 432
7 SASI_Rn01_00132656 predicted 461
8 SASI_Rn01_00132657 predicted 426
9 SASI_Rn01_00132658 predicted 508
10 SASI_Rn01_00132659 predicted 502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031198 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198518 predicted 599
2 SASI_Mm01_00198519 predicted 647
3 SASI_Mm01_00198521 predicted 1219
4 SASI_Mm01_00198522 predicted 1017
5 SASI_Mm01_00198523 predicted 793
6 SASI_Mm01_00198524 predicted 510
7 SASI_Mm01_00198525 predicted 614
8 SASI_Mm01_00198526 predicted 426
9 SASI_Mm01_00198527 predicted 369
10 SASI_Mm02_00337061 predicted 1077
11 SASI_Mm01_00198520 predicted 823
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012252
TFEC MISSION shRNA Bacterial Glycerol Stock
transcription factor EC
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012252.1-1446s1c1
Sequence:CCGGCGGAGTCCAAATCCACTTAAACTCGAGTTTAAGTGGATTTGGACTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012252.1-1068s1c1
Sequence:CCGGGCTGCATTGAAAGAGGAACAACTCGAGTTGTTCCTCTTTCAATGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012252.1-681s1c1
Sequence:CCGGCCAAAGTCTAATGATCCTGATCTCGAGATCAGGATCATTAGACTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012252.1-531s1c1
Sequence:CCGGCCAAGTAGTCTACCAATGAAACTCGAGTTTCATTGGTAGACTACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012252.1-1035s1c1
Sequence:CCGGCCTTTGTCATACTTCACAGATCTCGAGATCTGTGAAGTATGACAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012252.2-893s21c1
Sequence:CCGGTCACTTGGCACGGTTGATTTACTCGAGTAAATCAACCGTGCCAAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012252
TFEC MISSION shRNA shRNA Plasmid DNA
transcription factor EC
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012252.1-1446s1c1
Sequence:CCGGCGGAGTCCAAATCCACTTAAACTCGAGTTTAAGTGGATTTGGACTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012252.1-1068s1c1
Sequence:CCGGGCTGCATTGAAAGAGGAACAACTCGAGTTGTTCCTCTTTCAATGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012252.1-681s1c1
Sequence:CCGGCCAAAGTCTAATGATCCTGATCTCGAGATCAGGATCATTAGACTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012252.1-531s1c1
Sequence:CCGGCCAAGTAGTCTACCAATGAAACTCGAGTTTCATTGGTAGACTACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012252.1-1035s1c1
Sequence:CCGGCCTTTGTCATACTTCACAGATCTCGAGATCTGTGAAGTATGACAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012252.2-893s21c1
Sequence:CCGGTCACTTGGCACGGTTGATTTACTCGAGTAAATCAACCGTGCCAAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012252
TFEC MISSION shRNA Lentiviral Transduction Particles
transcription factor EC
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012252.1-1446s1c1
Sequence:CCGGCGGAGTCCAAATCCACTTAAACTCGAGTTTAAGTGGATTTGGACTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012252.1-1068s1c1
Sequence:CCGGGCTGCATTGAAAGAGGAACAACTCGAGTTGTTCCTCTTTCAATGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012252.1-681s1c1
Sequence:CCGGCCAAAGTCTAATGATCCTGATCTCGAGATCAGGATCATTAGACTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012252.1-531s1c1
Sequence:CCGGCCAAGTAGTCTACCAATGAAACTCGAGTTTCATTGGTAGACTACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012252.1-1035s1c1
Sequence:CCGGCCTTTGTCATACTTCACAGATCTCGAGATCTGTGAAGTATGACAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012252.2-893s21c1
Sequence:CCGGTCACTTGGCACGGTTGATTTACTCGAGTAAATCAACCGTGCCAAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031198
TFEC MISSION shRNA Bacterial Glycerol Stock
transcription factor EC
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031198.1-1288s1c1
Sequence:CCGGGCTTTCACTTAACTCTCTGAACTCGAGTTCAGAGAGTTAAGTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031198.1-1052s1c1
Sequence:CCGGGCCGCTTTGAAAGAGGAACAACTCGAGTTGTTCCTCTTTCAAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031198.1-1019s1c1
Sequence:CCGGCCATTGTCTCACTTCACAGATCTCGAGATCTGTGAAGTGAGACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031198.1-515s1c1
Sequence:CCGGCCAAGTATTCTACCCATGAGACTCGAGTCTCATGGGTAGAATACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031198.1-417s1c1
Sequence:CCGGGTGCTGAGAAATGGCATTTATCTCGAGATAAATGCCATTTCTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031198.2-417s21c1
Sequence:CCGGGTGCTGAGAAATGGCATTTATCTCGAGATAAATGCCATTTCTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031198.2-503s21c1
Sequence:CCGGGATGCTCCTTGTCCAAGTATTCTCGAGAATACTTGGACAAGGAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031198.2-1504s21c1
Sequence:CCGGCAGTGACATGCTAGGATATTGCTCGAGCAATATCCTAGCATGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031198.2-694s21c1
Sequence:GTACCGGGAACAAAGGGACCATTCTAAACTCGAGTTTAGAATGGTCCCTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031198.2-1085s21c1
Sequence:CCGGATGCTACTAAGTGATACAATACTCGAGTATTGTATCACTTAGTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031198
TFEC MISSION shRNA shRNA Plasmid DNA
transcription factor EC
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031198.1-1288s1c1
Sequence:CCGGGCTTTCACTTAACTCTCTGAACTCGAGTTCAGAGAGTTAAGTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031198.1-1052s1c1
Sequence:CCGGGCCGCTTTGAAAGAGGAACAACTCGAGTTGTTCCTCTTTCAAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031198.1-1019s1c1
Sequence:CCGGCCATTGTCTCACTTCACAGATCTCGAGATCTGTGAAGTGAGACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031198.1-515s1c1
Sequence:CCGGCCAAGTATTCTACCCATGAGACTCGAGTCTCATGGGTAGAATACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031198.1-417s1c1
Sequence:CCGGGTGCTGAGAAATGGCATTTATCTCGAGATAAATGCCATTTCTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031198.2-417s21c1
Sequence:CCGGGTGCTGAGAAATGGCATTTATCTCGAGATAAATGCCATTTCTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031198.2-503s21c1
Sequence:CCGGGATGCTCCTTGTCCAAGTATTCTCGAGAATACTTGGACAAGGAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031198.2-1504s21c1
Sequence:CCGGCAGTGACATGCTAGGATATTGCTCGAGCAATATCCTAGCATGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031198.2-694s21c1
Sequence:GTACCGGGAACAAAGGGACCATTCTAAACTCGAGTTTAGAATGGTCCCTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031198.2-1085s21c1
Sequence:CCGGATGCTACTAAGTGATACAATACTCGAGTATTGTATCACTTAGTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031198
TFEC MISSION shRNA Lentiviral Transduction Particles
transcription factor EC
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031198.1-1288s1c1
Sequence:CCGGGCTTTCACTTAACTCTCTGAACTCGAGTTCAGAGAGTTAAGTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031198.1-1052s1c1
Sequence:CCGGGCCGCTTTGAAAGAGGAACAACTCGAGTTGTTCCTCTTTCAAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031198.1-1019s1c1
Sequence:CCGGCCATTGTCTCACTTCACAGATCTCGAGATCTGTGAAGTGAGACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031198.1-515s1c1
Sequence:CCGGCCAAGTATTCTACCCATGAGACTCGAGTCTCATGGGTAGAATACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031198.1-417s1c1
Sequence:CCGGGTGCTGAGAAATGGCATTTATCTCGAGATAAATGCCATTTCTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031198.2-417s21c1
Sequence:CCGGGTGCTGAGAAATGGCATTTATCTCGAGATAAATGCCATTTCTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031198.2-503s21c1
Sequence:CCGGGATGCTCCTTGTCCAAGTATTCTCGAGAATACTTGGACAAGGAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031198.2-1504s21c1
Sequence:CCGGCAGTGACATGCTAGGATATTGCTCGAGCAATATCCTAGCATGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031198.2-694s21c1
Sequence:GTACCGGGAACAAAGGGACCATTCTAAACTCGAGTTTAGAATGGTCCCTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031198.2-1085s21c1
Sequence:CCGGATGCTACTAAGTGATACAATACTCGAGTATTGTATCACTTAGTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks