EMAIL THIS PAGE TO A FRIEND

TFF1

trefoil factor 1

Synonyms: BCEI D21S21 HP1.A HPS2 pNR-2 pS2
UniProtKB ID: P04155
Gene ID:
Human(7031) Summary: Members of the trefoil family are characterized by having at least one copy of the trefoil motif, a 40-amino acid domain that contains three conserved disulfides. They are stable secretory proteins expressed in gastrointestinal mucosa. Their functions are not defined, but they may protect the mucosa from insults, stabilize the mucus layer, and affect healing of the epithelium. This gene, which is expressed in the gastric mucosa, has also been studied because of its expression in human tumors. This gene and two other related trefoil family member genes are found in a cluster on chromosome 21. [provided by RefSeq, Jul 2008]
Mouse(21784) trefoil factor 1
Rat(117270) trefoil factor 1
cow(100301237) trefoil factor 1
sheep(101104450) trefoil factor 1
domestic cat(100170654) trefoil factor 1
dog(403491) trefoil factor 1
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003225 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003225 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003225 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009362 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009362 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009362 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU057351 MISSION® esiRNA esiRNA human TFF1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003225 Rosetta Predictions human pricing
NM_057129 Rosetta Predictions rat pricing
NM_009362 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003225 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121166 predicted 232
2 SASI_Hs01_00121167 predicted 240
3 SASI_Hs01_00121168 predicted 199
4 SASI_Hs01_00121169 predicted 230
5 SASI_Hs01_00121170 predicted 202
6 SASI_Hs01_00121171 predicted 194
7 SASI_Hs01_00121172 predicted 253
8 SASI_Hs01_00121173 predicted 252
9 SASI_Hs01_00121174 predicted 237
10 SASI_Hs02_00335263 predicted 299
11 SASI_Hs01_00121175 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057129 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063305 predicted 225
2 SASI_Rn01_00063306 predicted 220
3 SASI_Rn01_00063307 predicted 221
4 SASI_Rn01_00063308 predicted 233
5 SASI_Rn01_00063309 predicted 226
6 SASI_Rn01_00063310 predicted 223
7 SASI_Rn01_00063311 predicted 219
8 SASI_Rn01_00063312 predicted 235
9 SASI_Rn01_00063313 predicted 429
10 SASI_Rn01_00063314 predicted 257
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009362 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183550 predicted 258
2 SASI_Mm01_00183551 predicted 251
3 SASI_Mm01_00183552 predicted 253
4 SASI_Mm01_00183553 predicted 382
5 SASI_Mm01_00183554 predicted 366
6 SASI_Mm02_00315962 predicted 290
7 SASI_Mm01_00183555 predicted 442
8 SASI_Mm01_00183556 predicted 398
9 SASI_Mm01_00183557 predicted 281
10 SASI_Mm02_00315963 predicted 443
11 SASI_Mm01_00183558 predicted 228
12 SASI_Mm01_00183559 predicted 41
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003225
TFF1 MISSION shRNA Bacterial Glycerol Stock
trefoil factor 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003225.2-293s21c1
Sequence:CCGGTAGACACTTCTGCAGGGATCTCTCGAGAGATCCCTGCAGAAGTGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003225.2-248s21c1
Sequence:CCGGTATCCTAATACCATCGACGTCCTCGAGGACGTCGATGGTATTAGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003225.2-206s21c1
Sequence:CCGGTGCTGTTTCGACGACACCGTTCTCGAGAACGGTGTCGTCGAAACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003225.1-237s1c1
Sequence:CCGGCCTGGTGCTTCTATCCTAATACTCGAGTATTAGGATAGAAGCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003225.1-148s1c1
Sequence:CCGGTGAAAGACAGAATTGTGGTTTCTCGAGAAACCACAATTCTGTCTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003225.1-181s1c1
Sequence:CCGGGCCCTCCCAGTGTGCAAATAACTCGAGTTATTTGCACACTGGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003225.1-272s1c1
Sequence:CCGGCCAGAAGAGGAGTGTGAATTTCTCGAGAAATTCACACTCCTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003225.1-192s1c1
Sequence:CCGGGTGCAAATAAGGGCTGCTGTTCTCGAGAACAGCAGCCCTTATTTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003225
TFF1 MISSION shRNA shRNA Plasmid DNA
trefoil factor 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003225.2-293s21c1
Sequence:CCGGTAGACACTTCTGCAGGGATCTCTCGAGAGATCCCTGCAGAAGTGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003225.2-248s21c1
Sequence:CCGGTATCCTAATACCATCGACGTCCTCGAGGACGTCGATGGTATTAGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003225.2-206s21c1
Sequence:CCGGTGCTGTTTCGACGACACCGTTCTCGAGAACGGTGTCGTCGAAACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003225.1-237s1c1
Sequence:CCGGCCTGGTGCTTCTATCCTAATACTCGAGTATTAGGATAGAAGCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003225.1-148s1c1
Sequence:CCGGTGAAAGACAGAATTGTGGTTTCTCGAGAAACCACAATTCTGTCTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003225.1-181s1c1
Sequence:CCGGGCCCTCCCAGTGTGCAAATAACTCGAGTTATTTGCACACTGGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003225.1-272s1c1
Sequence:CCGGCCAGAAGAGGAGTGTGAATTTCTCGAGAAATTCACACTCCTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003225.1-192s1c1
Sequence:CCGGGTGCAAATAAGGGCTGCTGTTCTCGAGAACAGCAGCCCTTATTTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003225
TFF1 MISSION shRNA Lentiviral Transduction Particles
trefoil factor 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003225.2-293s21c1
Sequence:CCGGTAGACACTTCTGCAGGGATCTCTCGAGAGATCCCTGCAGAAGTGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003225.2-248s21c1
Sequence:CCGGTATCCTAATACCATCGACGTCCTCGAGGACGTCGATGGTATTAGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003225.2-206s21c1
Sequence:CCGGTGCTGTTTCGACGACACCGTTCTCGAGAACGGTGTCGTCGAAACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003225.1-237s1c1
Sequence:CCGGCCTGGTGCTTCTATCCTAATACTCGAGTATTAGGATAGAAGCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003225.1-148s1c1
Sequence:CCGGTGAAAGACAGAATTGTGGTTTCTCGAGAAACCACAATTCTGTCTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003225.1-181s1c1
Sequence:CCGGGCCCTCCCAGTGTGCAAATAACTCGAGTTATTTGCACACTGGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003225.1-272s1c1
Sequence:CCGGCCAGAAGAGGAGTGTGAATTTCTCGAGAAATTCACACTCCTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003225.1-192s1c1
Sequence:CCGGGTGCAAATAAGGGCTGCTGTTCTCGAGAACAGCAGCCCTTATTTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009362
TFF1 MISSION shRNA Bacterial Glycerol Stock
trefoil factor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009362.1-273s1c1
Sequence:CCGGTCCTGAGAGAACTGGCTACATCTCGAGATGTAGCCAGTTCTCTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009362.1-89s1c1
Sequence:CCGGCCAGGAAGAAACATGTATCATCTCGAGATGATACATGTTTCTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009362.1-245s1c1
Sequence:CCGGAGAAGAAGAATGTCCCTTCTACTCGAGTAGAAGGGACATTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009362.1-163s1c1
Sequence:CCGGGCACGGAGAGAGGTTGCTGTTCTCGAGAACAGCAACCTCTCTCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009362.1-228s1c1
Sequence:CCGGGCCATCGAGAACACTCAAGAACTCGAGTTCTTGAGTGTTCTCGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009362
TFF1 MISSION shRNA shRNA Plasmid DNA
trefoil factor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009362.1-273s1c1
Sequence:CCGGTCCTGAGAGAACTGGCTACATCTCGAGATGTAGCCAGTTCTCTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009362.1-89s1c1
Sequence:CCGGCCAGGAAGAAACATGTATCATCTCGAGATGATACATGTTTCTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009362.1-245s1c1
Sequence:CCGGAGAAGAAGAATGTCCCTTCTACTCGAGTAGAAGGGACATTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009362.1-163s1c1
Sequence:CCGGGCACGGAGAGAGGTTGCTGTTCTCGAGAACAGCAACCTCTCTCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009362.1-228s1c1
Sequence:CCGGGCCATCGAGAACACTCAAGAACTCGAGTTCTTGAGTGTTCTCGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009362
TFF1 MISSION shRNA Lentiviral Transduction Particles
trefoil factor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009362.1-273s1c1
Sequence:CCGGTCCTGAGAGAACTGGCTACATCTCGAGATGTAGCCAGTTCTCTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009362.1-89s1c1
Sequence:CCGGCCAGGAAGAAACATGTATCATCTCGAGATGATACATGTTTCTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009362.1-245s1c1
Sequence:CCGGAGAAGAAGAATGTCCCTTCTACTCGAGTAGAAGGGACATTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009362.1-163s1c1
Sequence:CCGGGCACGGAGAGAGGTTGCTGTTCTCGAGAACAGCAACCTCTCTCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009362.1-228s1c1
Sequence:CCGGGCCATCGAGAACACTCAAGAACTCGAGTTCTTGAGTGTTCTCGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks