EMAIL THIS PAGE TO A FRIEND

TFF2

trefoil factor 2

Synonyms: SML1 SP
UniProtKB ID: Q03403, Q15854
Gene ID:
Human(7032) Summary: Members of the trefoil family are characterized by having at least one copy of the trefoil motif, a 40-amino acid domain that contains three conserved disulfides. They are stable secretory proteins expressed in gastrointestinal mucosa. Their functions are not defined, but they may protect the mucosa from insults, stabilize the mucus layer and affect healing of the epithelium. The encoded protein inhibits gastric acid secretion. This gene and two other related trefoil family member genes are found in a cluster on chromosome 21. [provided by RefSeq, Jul 2008]
Mouse(21785) trefoil factor 2 (spasmolytic protein 1)
Rat(116592) trefoil factor 2
chicken(418534) trefoil factor 2
domestic cat(100170653) trefoil factor 2
dog(403489) trefoil factor 2
cow(616105) trefoil factor 2
sheep(101104197) trefoil factor 2
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005423 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005423 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005423 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009363 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009363 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009363 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU087381 MISSION® esiRNA esiRNA targeting mouse Tff2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005423 Rosetta Predictions human pricing
NM_053844 Rosetta Predictions rat pricing
NM_009363 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005423 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229467 predicted 356
2 SASI_Hs01_00229468 predicted 269
3 SASI_Hs01_00229469 predicted 286
4 SASI_Hs01_00229470 predicted 269
5 SASI_Hs01_00229471 predicted 278
6 SASI_Hs01_00229472 predicted 348
7 SASI_Hs01_00229473 predicted 342
8 SASI_Hs01_00229474 predicted 208
9 SASI_Hs01_00229475 predicted 285
10 SASI_Hs01_00229476 predicted 329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053844 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100866 predicted 259
2 SASI_Rn01_00100867 predicted 278
3 SASI_Rn01_00100868 predicted 320
4 SASI_Rn01_00100869 predicted 256
5 SASI_Rn01_00100870 predicted 260
6 SASI_Rn01_00100871 predicted 285
7 SASI_Rn01_00100872 predicted 245
8 SASI_Rn01_00100873 predicted 282
9 SASI_Rn01_00100874 predicted 244
10 SASI_Rn01_00100875 predicted 242
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009363 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315964 predicted 321
2 SASI_Mm01_00197774 predicted 227
3 SASI_Mm01_00197775 predicted 266
4 SASI_Mm01_00197776 predicted 264
5 SASI_Mm02_00315965 predicted 283
6 SASI_Mm01_00197777 predicted 235
7 SASI_Mm01_00197778 predicted 279
8 SASI_Mm01_00197779 predicted 244
9 SASI_Mm01_00197781 predicted 309
10 SASI_Mm01_00197783 predicted 323
11 SASI_Mm01_00197780 predicted 335
12 SASI_Mm01_00197782 predicted 265
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005423
TFF2 MISSION shRNA Bacterial Glycerol Stock
trefoil factor 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005423.2-153s1c1
Sequence:CCGGCCCTGGAATCACCAGTGACCACTCGAGTGGTCACTGGTGATTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005423.2-386s1c1
Sequence:CCGGAGTCTGTGGAAGACTGCCATTCTCGAGAATGGCAGTCTTCCACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005423.2-279s1c1
Sequence:CCGGAGACCGAAGAAACTGTGGCTACTCGAGTAGCCACAGTTTCTTCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005423.2-350s1c1
Sequence:CCGGACTTCATCTTTGAAGTGCCCTCTCGAGAGGGCACTTCAAAGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005423.2-238s1c1
Sequence:CCGGCTCCCAAAGCAAGAGTCGGATCTCGAGATCCGACTCTTGCTTTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005423.4-540s21c1
Sequence:CCGGTGGTTCCAGAGGATGCATCTGCTCGAGCAGATGCATCCTCTGGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005423.4-249s21c1
Sequence:CCGGCCCATAACAGGACGAACTGCGCTCGAGCGCAGTTCGTCCTGTTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005423.4-299s21c1
Sequence:CCGGTTTGACAATGGATGCTGTTTCCTCGAGGAAACAGCATCCATTGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005423.4-438s21c1
Sequence:CCGGAGGAATGCGCCTCTCGGAAGTCTCGAGACTTCCGAGAGGCGCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005423
TFF2 MISSION shRNA shRNA Plasmid DNA
trefoil factor 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005423.2-153s1c1
Sequence:CCGGCCCTGGAATCACCAGTGACCACTCGAGTGGTCACTGGTGATTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005423.2-386s1c1
Sequence:CCGGAGTCTGTGGAAGACTGCCATTCTCGAGAATGGCAGTCTTCCACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005423.2-279s1c1
Sequence:CCGGAGACCGAAGAAACTGTGGCTACTCGAGTAGCCACAGTTTCTTCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005423.2-350s1c1
Sequence:CCGGACTTCATCTTTGAAGTGCCCTCTCGAGAGGGCACTTCAAAGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005423.2-238s1c1
Sequence:CCGGCTCCCAAAGCAAGAGTCGGATCTCGAGATCCGACTCTTGCTTTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005423.4-540s21c1
Sequence:CCGGTGGTTCCAGAGGATGCATCTGCTCGAGCAGATGCATCCTCTGGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005423.4-249s21c1
Sequence:CCGGCCCATAACAGGACGAACTGCGCTCGAGCGCAGTTCGTCCTGTTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005423.4-299s21c1
Sequence:CCGGTTTGACAATGGATGCTGTTTCCTCGAGGAAACAGCATCCATTGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005423.4-438s21c1
Sequence:CCGGAGGAATGCGCCTCTCGGAAGTCTCGAGACTTCCGAGAGGCGCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005423
TFF2 MISSION shRNA Lentiviral Transduction Particles
trefoil factor 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005423.2-153s1c1
Sequence:CCGGCCCTGGAATCACCAGTGACCACTCGAGTGGTCACTGGTGATTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005423.2-386s1c1
Sequence:CCGGAGTCTGTGGAAGACTGCCATTCTCGAGAATGGCAGTCTTCCACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005423.2-279s1c1
Sequence:CCGGAGACCGAAGAAACTGTGGCTACTCGAGTAGCCACAGTTTCTTCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005423.2-350s1c1
Sequence:CCGGACTTCATCTTTGAAGTGCCCTCTCGAGAGGGCACTTCAAAGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005423.2-238s1c1
Sequence:CCGGCTCCCAAAGCAAGAGTCGGATCTCGAGATCCGACTCTTGCTTTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005423.4-540s21c1
Sequence:CCGGTGGTTCCAGAGGATGCATCTGCTCGAGCAGATGCATCCTCTGGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005423.4-249s21c1
Sequence:CCGGCCCATAACAGGACGAACTGCGCTCGAGCGCAGTTCGTCCTGTTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005423.4-299s21c1
Sequence:CCGGTTTGACAATGGATGCTGTTTCCTCGAGGAAACAGCATCCATTGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005423.4-438s21c1
Sequence:CCGGAGGAATGCGCCTCTCGGAAGTCTCGAGACTTCCGAGAGGCGCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009363
VALIDATED
TFF2 MISSION shRNA Bacterial Glycerol Stock
trefoil factor 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009363.2-146s1c1
Sequence:CCGGCAACAGAAAGAACTGTGGCTTCTCGAGAAGCCACAGTTCTTTCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009363.2-293s1c1
Sequence:CCGGAGCTCGCAAGAATTGTGGGTACTCGAGTACCCACAATTCTTGCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009363.2-90s1c1
Sequence:CCGGGCTCTGGTAGAGGGCGAGAAACTCGAGTTTCTCGCCCTCTACCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009363.2-396s1c1
Sequence:CCGGCCACAGTCTGTGGAAGATTGTCTCGAGACAATCTTCCACAGACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009363.2-190s1c1
Sequence:CCGGGCTTTGATCTTGGATGCTGCTCTCGAGAGCAGCATCCAAGATCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009363.3-145s21c1
Sequence:CCGGCAACAGAAAGAACTGTGGCTTCTCGAGAAGCCACAGTTCTTTCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009363.3-89s21c1
Sequence:CCGGGCTCTGGTAGAGGGCGAGAAACTCGAGTTTCTCGCCCTCTACCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009363.3-395s21c1
Sequence:CCGGCCACAGTCTGTGGAAGATTGTCTCGAGACAATCTTCCACAGACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009363.3-292s21c1
Sequence:CCGGAGCTCGCAAGAATTGTGGGTACTCGAGTACCCACAATTCTTGCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009363.3-189s21c1
Sequence:CCGGGCTTTGATCTTGGATGCTGCTCTCGAGAGCAGCATCCAAGATCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009363
VALIDATED
TFF2 MISSION shRNA shRNA Plasmid DNA
trefoil factor 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009363.2-146s1c1
Sequence:CCGGCAACAGAAAGAACTGTGGCTTCTCGAGAAGCCACAGTTCTTTCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009363.2-293s1c1
Sequence:CCGGAGCTCGCAAGAATTGTGGGTACTCGAGTACCCACAATTCTTGCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009363.2-90s1c1
Sequence:CCGGGCTCTGGTAGAGGGCGAGAAACTCGAGTTTCTCGCCCTCTACCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009363.2-396s1c1
Sequence:CCGGCCACAGTCTGTGGAAGATTGTCTCGAGACAATCTTCCACAGACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009363.2-190s1c1
Sequence:CCGGGCTTTGATCTTGGATGCTGCTCTCGAGAGCAGCATCCAAGATCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009363.3-145s21c1
Sequence:CCGGCAACAGAAAGAACTGTGGCTTCTCGAGAAGCCACAGTTCTTTCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009363.3-89s21c1
Sequence:CCGGGCTCTGGTAGAGGGCGAGAAACTCGAGTTTCTCGCCCTCTACCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009363.3-395s21c1
Sequence:CCGGCCACAGTCTGTGGAAGATTGTCTCGAGACAATCTTCCACAGACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009363.3-292s21c1
Sequence:CCGGAGCTCGCAAGAATTGTGGGTACTCGAGTACCCACAATTCTTGCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009363.3-189s21c1
Sequence:CCGGGCTTTGATCTTGGATGCTGCTCTCGAGAGCAGCATCCAAGATCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009363
VALIDATED
TFF2 MISSION shRNA Lentiviral Transduction Particles
trefoil factor 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009363.2-146s1c1
Sequence:CCGGCAACAGAAAGAACTGTGGCTTCTCGAGAAGCCACAGTTCTTTCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009363.2-293s1c1
Sequence:CCGGAGCTCGCAAGAATTGTGGGTACTCGAGTACCCACAATTCTTGCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009363.2-90s1c1
Sequence:CCGGGCTCTGGTAGAGGGCGAGAAACTCGAGTTTCTCGCCCTCTACCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009363.2-396s1c1
Sequence:CCGGCCACAGTCTGTGGAAGATTGTCTCGAGACAATCTTCCACAGACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009363.2-190s1c1
Sequence:CCGGGCTTTGATCTTGGATGCTGCTCTCGAGAGCAGCATCCAAGATCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009363.3-145s21c1
Sequence:CCGGCAACAGAAAGAACTGTGGCTTCTCGAGAAGCCACAGTTCTTTCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009363.3-89s21c1
Sequence:CCGGGCTCTGGTAGAGGGCGAGAAACTCGAGTTTCTCGCCCTCTACCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009363.3-395s21c1
Sequence:CCGGCCACAGTCTGTGGAAGATTGTCTCGAGACAATCTTCCACAGACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009363.3-292s21c1
Sequence:CCGGAGCTCGCAAGAATTGTGGGTACTCGAGTACCCACAATTCTTGCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009363.3-189s21c1
Sequence:CCGGGCTTTGATCTTGGATGCTGCTCTCGAGAGCAGCATCCAAGATCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks