EMAIL THIS PAGE TO A FRIEND

TFF3

trefoil factor 3 (intestinal)

Synonyms: ITF P1B TFI
UniProtKB ID: Q07654, E9PBB5, Q96NX0, Q9UDA5
Gene ID:
Human(7033) Summary: Members of the trefoil family are characterized by having at least one copy of the trefoil motif, a 40-amino acid domain that contains three conserved disulfides. They are stable secretory proteins expressed in gastrointestinal mucosa. Their functions are not defined, but they may protect the mucosa from insults, stabilize the mucus layer and affect healing of the epithelium. This gene is expressed in goblet cells of the intestines and colon. This gene and two other related trefoil family member genes are found in a cluster on chromosome 21. [provided by RefSeq, Jul 2008]
Mouse(21786) trefoil factor 3, intestinal
Rat(25563) trefoil factor 3, intestinal
cow(517889) trefoil factor 3 (intestinal)
sheep(780497) trefoil factor 3 (intestinal)
domestic guinea pig(100732911) trefoil factor 3 (intestinal)
naked mole-rat(101710760) trefoil factor 3 (intestinal)
dog(403488) trefoil factor 3 (intestinal)
domestic cat(100170655) trefoil factor 3 (intestinal)
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011575 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011575 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011575 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003226 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003226 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003226 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU052851 MISSION® esiRNA esiRNA human TFF3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003226 Rosetta Predictions human pricing
NM_013042 Rosetta Predictions rat pricing
NM_011575 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003226 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189080 predicted 406
2 SASI_Hs01_00189081 predicted 272
3 SASI_Hs01_00189083 predicted 400
4 SASI_Hs01_00189084 predicted 437
5 SASI_Hs01_00189085 predicted 206
6 SASI_Hs01_00189086 predicted 225
7 SASI_Hs01_00189087 predicted 304
8 SASI_Hs02_00335264 predicted 290
9 SASI_Hs02_00335265 predicted 295
10 SASI_Hs02_00335266 predicted 293
11 SASI_Hs01_00189078 predicted 413
12 SASI_Hs01_00189079 predicted 416
13 SASI_Hs01_00189082 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013042 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050026 predicted 212
2 SASI_Rn01_00050027 predicted 203
3 SASI_Rn01_00050028 predicted 200
4 SASI_Rn01_00050029 predicted 300
5 SASI_Rn01_00050030 predicted 95
6 SASI_Rn01_00050031 predicted 107
7 SASI_Rn01_00050032 predicted 20
8 SASI_Rn01_00050033 predicted 108
9 SASI_Rn01_00050034 predicted 83
10 SASI_Rn01_00050035 predicted 69
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011575 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108604 predicted 206
2 SASI_Mm01_00108605 predicted 194
3 SASI_Mm01_00108606 predicted 225
4 SASI_Mm01_00108607 predicted 226
5 SASI_Mm01_00108608 predicted 221
6 SASI_Mm01_00108609 predicted 205
7 SASI_Mm01_00108610 predicted 114
8 SASI_Mm01_00108613 predicted 37
9 SASI_Mm02_00320966 predicted 50
10 SASI_Mm02_00320967 predicted 239
11 SASI_Mm01_00108611 predicted 131
12 SASI_Mm01_00108612 predicted 420
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011575
VALIDATED
TFF3 MISSION shRNA Bacterial Glycerol Stock
trefoil factor 3 (intestinal)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011575.2-89s21c1
Sequence:CCGGCTCTGGGATAGCTGCAGATTACTCGAGTAATCTGCAGCTATCCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011575.2-236s21c1
Sequence:CCGGGCCCTGGTGCTTCAAACCTCTCTCGAGAGAGGTTTGAAGCACCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011575.2-212s21c1
Sequence:CCGGCTTTGACTCCAGTATCCCAAACTCGAGTTTGGGATACTGGAGTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011575.2-172s21c1
Sequence:CCGGCCTCTGTCACATCGGAGCAGTCTCGAGACTGCTCCGATGTGACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011575.2-129s21c1
Sequence:CCGGCAATGTATGGTGCCGGCAAATCTCGAGATTTGCCGGCACCATACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011575.1-212s1c1
Sequence:CCGGCTTTGACTCCAGTATCCCAAACTCGAGTTTGGGATACTGGAGTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011575.1-89s1c1
Sequence:CCGGCTCTGGGATAGCTGCAGATTACTCGAGTAATCTGCAGCTATCCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011575.1-172s1c1
Sequence:CCGGCCTCTGTCACATCGGAGCAGTCTCGAGACTGCTCCGATGTGACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011575.1-236s1c1
Sequence:CCGGGCCCTGGTGCTTCAAACCTCTCTCGAGAGAGGTTTGAAGCACCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011575.1-129s1c1
Sequence:CCGGCAATGTATGGTGCCGGCAAATCTCGAGATTTGCCGGCACCATACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011575
VALIDATED
TFF3 MISSION shRNA shRNA Plasmid DNA
trefoil factor 3 (intestinal)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011575.2-89s21c1
Sequence:CCGGCTCTGGGATAGCTGCAGATTACTCGAGTAATCTGCAGCTATCCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011575.2-236s21c1
Sequence:CCGGGCCCTGGTGCTTCAAACCTCTCTCGAGAGAGGTTTGAAGCACCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011575.2-212s21c1
Sequence:CCGGCTTTGACTCCAGTATCCCAAACTCGAGTTTGGGATACTGGAGTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011575.2-172s21c1
Sequence:CCGGCCTCTGTCACATCGGAGCAGTCTCGAGACTGCTCCGATGTGACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011575.2-129s21c1
Sequence:CCGGCAATGTATGGTGCCGGCAAATCTCGAGATTTGCCGGCACCATACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011575.1-212s1c1
Sequence:CCGGCTTTGACTCCAGTATCCCAAACTCGAGTTTGGGATACTGGAGTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011575.1-89s1c1
Sequence:CCGGCTCTGGGATAGCTGCAGATTACTCGAGTAATCTGCAGCTATCCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011575.1-172s1c1
Sequence:CCGGCCTCTGTCACATCGGAGCAGTCTCGAGACTGCTCCGATGTGACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011575.1-236s1c1
Sequence:CCGGGCCCTGGTGCTTCAAACCTCTCTCGAGAGAGGTTTGAAGCACCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011575.1-129s1c1
Sequence:CCGGCAATGTATGGTGCCGGCAAATCTCGAGATTTGCCGGCACCATACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011575
VALIDATED
TFF3 MISSION shRNA Lentiviral Transduction Particles
trefoil factor 3 (intestinal)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011575.2-89s21c1
Sequence:CCGGCTCTGGGATAGCTGCAGATTACTCGAGTAATCTGCAGCTATCCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011575.2-236s21c1
Sequence:CCGGGCCCTGGTGCTTCAAACCTCTCTCGAGAGAGGTTTGAAGCACCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011575.2-212s21c1
Sequence:CCGGCTTTGACTCCAGTATCCCAAACTCGAGTTTGGGATACTGGAGTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011575.2-172s21c1
Sequence:CCGGCCTCTGTCACATCGGAGCAGTCTCGAGACTGCTCCGATGTGACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011575.2-129s21c1
Sequence:CCGGCAATGTATGGTGCCGGCAAATCTCGAGATTTGCCGGCACCATACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011575.1-212s1c1
Sequence:CCGGCTTTGACTCCAGTATCCCAAACTCGAGTTTGGGATACTGGAGTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011575.1-89s1c1
Sequence:CCGGCTCTGGGATAGCTGCAGATTACTCGAGTAATCTGCAGCTATCCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011575.1-172s1c1
Sequence:CCGGCCTCTGTCACATCGGAGCAGTCTCGAGACTGCTCCGATGTGACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011575.1-236s1c1
Sequence:CCGGGCCCTGGTGCTTCAAACCTCTCTCGAGAGAGGTTTGAAGCACCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011575.1-129s1c1
Sequence:CCGGCAATGTATGGTGCCGGCAAATCTCGAGATTTGCCGGCACCATACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003226
VALIDATED
TFF3 MISSION shRNA Bacterial Glycerol Stock
trefoil factor 3 (intestinal)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003226.2-440s21c1
Sequence:CCGGTGCAGGAAGCAGAATGCACCTCTCGAGAGGTGCATTCTGCTTCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003226.2-414s21c1
Sequence:CCGGTGGAGTGCCTTGGTGTTTCAACTCGAGTTGAAACACCAAGGCACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003226.2-292s21c1
Sequence:CCGGTACGTGGGCCTGTCTGCAAACCTCGAGGTTTGCAGACAGGCCCACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003226.2-146s21c1
Sequence:CCGGGCAAACAACGGTGCATAAATGCTCGAGCATTTATGCACCGTTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003226.2-120s21c1
Sequence:CCGGCCAAGCAAACAATCCAGAGCACTCGAGTGCTCTGGATTGTTTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033624    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003226.1-242s1c1
Sequence:CCGGCCCTGGGATGCAGGCTGAGCACTCGAGTGCTCAGCCTGCATCCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003226.1-195s1c1
Sequence:CCGGCCCTGACTAGGAAGACAGAATCTCGAGATTCTGTCTTCCTAGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003226.1-172s1c1
Sequence:CCGGTGGAGTGCCTTGGTGTTTCAACTCGAGTTGAAACACCAAGGCACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003226.1-44s1c1
Sequence:CCGGGAGGAGTACGTGGGCCTGTCTCTCGAGAGACAGGCCCACGTACTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003226.1-61s1c1
Sequence:CCGGGTCTGCAAACCAGTGTGCCGTCTCGAGACGGCACACTGGTTTGCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003226
VALIDATED
TFF3 MISSION shRNA shRNA Plasmid DNA
trefoil factor 3 (intestinal)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003226.2-440s21c1
Sequence:CCGGTGCAGGAAGCAGAATGCACCTCTCGAGAGGTGCATTCTGCTTCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003226.2-414s21c1
Sequence:CCGGTGGAGTGCCTTGGTGTTTCAACTCGAGTTGAAACACCAAGGCACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003226.2-292s21c1
Sequence:CCGGTACGTGGGCCTGTCTGCAAACCTCGAGGTTTGCAGACAGGCCCACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003226.2-146s21c1
Sequence:CCGGGCAAACAACGGTGCATAAATGCTCGAGCATTTATGCACCGTTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003226.2-120s21c1
Sequence:CCGGCCAAGCAAACAATCCAGAGCACTCGAGTGCTCTGGATTGTTTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033624    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003226.1-242s1c1
Sequence:CCGGCCCTGGGATGCAGGCTGAGCACTCGAGTGCTCAGCCTGCATCCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003226.1-195s1c1
Sequence:CCGGCCCTGACTAGGAAGACAGAATCTCGAGATTCTGTCTTCCTAGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003226.1-172s1c1
Sequence:CCGGTGGAGTGCCTTGGTGTTTCAACTCGAGTTGAAACACCAAGGCACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003226.1-44s1c1
Sequence:CCGGGAGGAGTACGTGGGCCTGTCTCTCGAGAGACAGGCCCACGTACTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003226.1-61s1c1
Sequence:CCGGGTCTGCAAACCAGTGTGCCGTCTCGAGACGGCACACTGGTTTGCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003226
VALIDATED
TFF3 MISSION shRNA Lentiviral Transduction Particles
trefoil factor 3 (intestinal)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003226.2-440s21c1
Sequence:CCGGTGCAGGAAGCAGAATGCACCTCTCGAGAGGTGCATTCTGCTTCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003226.2-414s21c1
Sequence:CCGGTGGAGTGCCTTGGTGTTTCAACTCGAGTTGAAACACCAAGGCACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003226.2-292s21c1
Sequence:CCGGTACGTGGGCCTGTCTGCAAACCTCGAGGTTTGCAGACAGGCCCACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003226.2-146s21c1
Sequence:CCGGGCAAACAACGGTGCATAAATGCTCGAGCATTTATGCACCGTTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003226.2-120s21c1
Sequence:CCGGCCAAGCAAACAATCCAGAGCACTCGAGTGCTCTGGATTGTTTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033624    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003226.1-242s1c1
Sequence:CCGGCCCTGGGATGCAGGCTGAGCACTCGAGTGCTCAGCCTGCATCCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003226.1-195s1c1
Sequence:CCGGCCCTGACTAGGAAGACAGAATCTCGAGATTCTGTCTTCCTAGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003226.1-172s1c1
Sequence:CCGGTGGAGTGCCTTGGTGTTTCAACTCGAGTTGAAACACCAAGGCACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003226.1-44s1c1
Sequence:CCGGGAGGAGTACGTGGGCCTGTCTCTCGAGAGACAGGCCCACGTACTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003226.1-61s1c1
Sequence:CCGGGTCTGCAAACCAGTGTGCCGTCTCGAGACGGCACACTGGTTTGCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks