EMAIL THIS PAGE TO A FRIEND

TFG

TRK-fused gene

Synonyms: HMSNP SPG57 TF6 TRKT3
UniProtKB ID: Q92734, D3DN49, G5E9V1, Q15656, Q969I2
Gene ID:
Human(10342) Summary: There are several documented fusion oncoproteins encoded partially by this gene. This gene also participates in several oncogenic rearrangements resulting in anaplastic lymphoma and mixoid chondrosarcoma, and may play a role in the NF-kappaB pathway. Multiple transcript variants have been found for this gene. [provided by RefSeq, Sep 2010]
Mouse(21787) Trk-fused gene
Rat(360709) Trk-fused gene
Zebrafish(336466) trk-fused gene
domestic cat(101094042) TRK-fused gene
dog(487954) TRK-fused gene
chicken(418391) TRK-fused gene
naked mole-rat(101716893) TRK-fused gene
cow(505171) TRK-fused gene
sheep(101110985) TRK-fused gene
106 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019678 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019678 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019678 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006070 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006070 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006070 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007565 Rosetta Predictions human pricing
NM_006070 Rosetta Predictions human pricing
NM_001012144 Rosetta Predictions rat pricing
XM_573271 Rosetta Predictions rat pricing
NM_019678 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007565 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305349 predicted 672
2 SASI_Hs01_00158913 predicted 1151
3 SASI_Hs01_00158914 predicted 1123
4 SASI_Hs01_00158915 predicted 1146
5 SASI_Hs01_00158916 predicted 969
6 SASI_Hs01_00158917 predicted 1017
7 SASI_Hs01_00158918 predicted 1287
8 SASI_Hs01_00158919 predicted 838
9 SASI_Hs01_00158920 predicted 381
10 SASI_Hs01_00158921 predicted 463
11 SASI_Hs01_00158922 predicted 884
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006070 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340838 predicted 960
2 SASI_Hs01_00206654 predicted 1440
3 SASI_Hs01_00206655 predicted 1405
4 SASI_Hs01_00206656 predicted 1433
5 SASI_Hs01_00206657 predicted 1259
6 SASI_Hs01_00206658 predicted 1312
7 SASI_Hs01_00206659 predicted 1578
8 SASI_Hs01_00206660 predicted 1128
9 SASI_Hs01_00206661 predicted 669
10 SASI_Hs01_00206662 predicted 749
11 SASI_Hs01_00206663 predicted 1173
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012144 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104277 predicted 574
2 SASI_Rn01_00104278 predicted 1467
3 SASI_Rn01_00104280 predicted 1120
4 SASI_Rn01_00104281 predicted 554
5 SASI_Rn01_00104282 predicted 324
6 SASI_Rn02_00200320 predicted 1527
7 SASI_Rn01_00104283 predicted 964
8 SASI_Rn01_00104284 predicted 388
9 SASI_Rn01_00104285 predicted 1380
10 SASI_Rn02_00200321 predicted 1243
11 SASI_Rn01_00104279 predicted 410
12 SASI_Rn01_00104286 predicted 1519
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573271 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00179837 predicted 635
2 SASI_Rn01_00179838 predicted 622
3 SASI_Rn01_00179839 predicted 862
4 SASI_Rn01_00179840 predicted 832
5 SASI_Rn01_00179841 predicted 545
6 SASI_Rn01_00179842 predicted 648
7 SASI_Rn01_00179843 predicted 803
8 SASI_Rn01_00179844 predicted 558
9 SASI_Rn01_00179845 predicted 659
10 SASI_Rn01_00179846 predicted 786
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019678 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324754 predicted 669
2 SASI_Mm01_00083905 predicted 1070
3 SASI_Mm01_00083906 predicted 278
4 SASI_Mm01_00083907 predicted 1483
5 SASI_Mm01_00083908 predicted 344
6 SASI_Mm01_00083909 predicted 1342
7 SASI_Mm01_00083910 predicted 513
8 SASI_Mm02_00324755 predicted 663
9 SASI_Mm01_00083913 predicted 1196
10 SASI_Mm01_00083914 predicted 1350
11 SASI_Mm01_00083911 predicted 372
12 SASI_Mm01_00083912 predicted 922
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019678
VALIDATED
TFG MISSION shRNA Bacterial Glycerol Stock
TRK-fused gene
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079118    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019678.1-1680s1c1
Sequence:CCGGGCTTTCTAGTTTCCCAGAGAACTCGAGTTCTCTGGGAAACTAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019678.1-277s1c1
Sequence:CCGGCCGACGAATTCCCATTCATAACTCGAGTTATGAATGGGAATTCGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019678.1-530s1c1
Sequence:CCGGCGTCGAGAACTGGTAGAACTTCTCGAGAAGTTCTACCAGTTCTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019678.1-551s1c1
Sequence:CCGGCGAAATAAAGTGAATCGCTTACTCGAGTAAGCGATTCACTTTATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019678.1-334s1c1
Sequence:CCGGGCAGCGAGTATTCAGAGGAAACTCGAGTTTCCTCTGAATACTCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019678.2-327s21c1
Sequence:CCGGGCTAATGATGCAGCGAGTATTCTCGAGAATACTCGCTGCATCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339298    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019678.2-1625s21c1
Sequence:CCGGTGTAGCCGCTTCCTAGTTATTCTCGAGAATAACTAGGAAGCGGCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019678.2-1391s21c1
Sequence:CCGGCTGGACCTGGTTATCGATAAGCTCGAGCTTATCGATAACCAGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019678.2-1175s21c1
Sequence:CCGGCTTACCCTCCACAAACGTATACTCGAGTATACGTTTGTGGAGGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019678.2-540s21c1
Sequence:CCGGACTGGTAGAACTTCGAAATAACTCGAGTTATTTCGAAGTTCTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019678
VALIDATED
TFG MISSION shRNA shRNA Plasmid DNA
TRK-fused gene
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079118    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019678.1-1680s1c1
Sequence:CCGGGCTTTCTAGTTTCCCAGAGAACTCGAGTTCTCTGGGAAACTAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019678.1-277s1c1
Sequence:CCGGCCGACGAATTCCCATTCATAACTCGAGTTATGAATGGGAATTCGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019678.1-530s1c1
Sequence:CCGGCGTCGAGAACTGGTAGAACTTCTCGAGAAGTTCTACCAGTTCTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019678.1-551s1c1
Sequence:CCGGCGAAATAAAGTGAATCGCTTACTCGAGTAAGCGATTCACTTTATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019678.1-334s1c1
Sequence:CCGGGCAGCGAGTATTCAGAGGAAACTCGAGTTTCCTCTGAATACTCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019678.2-327s21c1
Sequence:CCGGGCTAATGATGCAGCGAGTATTCTCGAGAATACTCGCTGCATCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339298    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019678.2-1625s21c1
Sequence:CCGGTGTAGCCGCTTCCTAGTTATTCTCGAGAATAACTAGGAAGCGGCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019678.2-1391s21c1
Sequence:CCGGCTGGACCTGGTTATCGATAAGCTCGAGCTTATCGATAACCAGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019678.2-1175s21c1
Sequence:CCGGCTTACCCTCCACAAACGTATACTCGAGTATACGTTTGTGGAGGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019678.2-540s21c1
Sequence:CCGGACTGGTAGAACTTCGAAATAACTCGAGTTATTTCGAAGTTCTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019678
VALIDATED
TFG MISSION shRNA Lentiviral Transduction Particles
TRK-fused gene
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079118    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019678.1-1680s1c1
Sequence:CCGGGCTTTCTAGTTTCCCAGAGAACTCGAGTTCTCTGGGAAACTAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019678.1-277s1c1
Sequence:CCGGCCGACGAATTCCCATTCATAACTCGAGTTATGAATGGGAATTCGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019678.1-530s1c1
Sequence:CCGGCGTCGAGAACTGGTAGAACTTCTCGAGAAGTTCTACCAGTTCTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019678.1-551s1c1
Sequence:CCGGCGAAATAAAGTGAATCGCTTACTCGAGTAAGCGATTCACTTTATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019678.1-334s1c1
Sequence:CCGGGCAGCGAGTATTCAGAGGAAACTCGAGTTTCCTCTGAATACTCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019678.2-327s21c1
Sequence:CCGGGCTAATGATGCAGCGAGTATTCTCGAGAATACTCGCTGCATCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339298    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019678.2-1625s21c1
Sequence:CCGGTGTAGCCGCTTCCTAGTTATTCTCGAGAATAACTAGGAAGCGGCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019678.2-1391s21c1
Sequence:CCGGCTGGACCTGGTTATCGATAAGCTCGAGCTTATCGATAACCAGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019678.2-1175s21c1
Sequence:CCGGCTTACCCTCCACAAACGTATACTCGAGTATACGTTTGTGGAGGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019678.2-540s21c1
Sequence:CCGGACTGGTAGAACTTCGAAATAACTCGAGTTATTTCGAAGTTCTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006070
VALIDATED
TFG MISSION shRNA Bacterial Glycerol Stock
TRK-fused gene
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006070.4-1865s1c1
Sequence:CCGGCTTAGTTACTTTGGAACACTACTCGAGTAGTGTTCCAAAGTAACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_006070.4-1441s1c1
Sequence:CCGGCCCAAACTTCTCAGCCTACTACTCGAGTAGTAGGCTGAGAAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006070.4-1425s1c1
Sequence:CCGGGCACAAACTTACACTGCCCAACTCGAGTTGGGCAGTGTAAGTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006070.4-999s1c1
Sequence:CCGGGCGTTTGGCTTAACAGATGATCTCGAGATCATCTGTTAAGCCAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006070.4-1580s1c1
Sequence:CCGGGCCTAATCCTTATGCGCGTAACTCGAGTTACGCGCATAAGGATTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006070.4-1580s21c1
Sequence:CCGGGCCTAATCCTTATGCGCGTAACTCGAGTTACGCGCATAAGGATTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006070.4-999s21c1
Sequence:CCGGGCGTTTGGCTTAACAGATGATCTCGAGATCATCTGTTAAGCCAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006070.4-1865s21c1
Sequence:CCGGCTTAGTTACTTTGGAACACTACTCGAGTAGTGTTCCAAAGTAACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006070.4-1441s21c1
Sequence:CCGGCCCAAACTTCTCAGCCTACTACTCGAGTAGTAGGCTGAGAAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006070
VALIDATED
TFG MISSION shRNA shRNA Plasmid DNA
TRK-fused gene
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006070.4-1865s1c1
Sequence:CCGGCTTAGTTACTTTGGAACACTACTCGAGTAGTGTTCCAAAGTAACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_006070.4-1441s1c1
Sequence:CCGGCCCAAACTTCTCAGCCTACTACTCGAGTAGTAGGCTGAGAAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006070.4-1425s1c1
Sequence:CCGGGCACAAACTTACACTGCCCAACTCGAGTTGGGCAGTGTAAGTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006070.4-999s1c1
Sequence:CCGGGCGTTTGGCTTAACAGATGATCTCGAGATCATCTGTTAAGCCAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006070.4-1580s1c1
Sequence:CCGGGCCTAATCCTTATGCGCGTAACTCGAGTTACGCGCATAAGGATTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006070.4-1580s21c1
Sequence:CCGGGCCTAATCCTTATGCGCGTAACTCGAGTTACGCGCATAAGGATTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006070.4-999s21c1
Sequence:CCGGGCGTTTGGCTTAACAGATGATCTCGAGATCATCTGTTAAGCCAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006070.4-1865s21c1
Sequence:CCGGCTTAGTTACTTTGGAACACTACTCGAGTAGTGTTCCAAAGTAACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006070.4-1441s21c1
Sequence:CCGGCCCAAACTTCTCAGCCTACTACTCGAGTAGTAGGCTGAGAAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006070
VALIDATED
TFG MISSION shRNA Lentiviral Transduction Particles
TRK-fused gene
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006070.4-1865s1c1
Sequence:CCGGCTTAGTTACTTTGGAACACTACTCGAGTAGTGTTCCAAAGTAACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_006070.4-1441s1c1
Sequence:CCGGCCCAAACTTCTCAGCCTACTACTCGAGTAGTAGGCTGAGAAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006070.4-1425s1c1
Sequence:CCGGGCACAAACTTACACTGCCCAACTCGAGTTGGGCAGTGTAAGTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006070.4-999s1c1
Sequence:CCGGGCGTTTGGCTTAACAGATGATCTCGAGATCATCTGTTAAGCCAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006070.4-1580s1c1
Sequence:CCGGGCCTAATCCTTATGCGCGTAACTCGAGTTACGCGCATAAGGATTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006070.4-1580s21c1
Sequence:CCGGGCCTAATCCTTATGCGCGTAACTCGAGTTACGCGCATAAGGATTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006070.4-999s21c1
Sequence:CCGGGCGTTTGGCTTAACAGATGATCTCGAGATCATCTGTTAAGCCAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006070.4-1865s21c1
Sequence:CCGGCTTAGTTACTTTGGAACACTACTCGAGTAGTGTTCCAAAGTAACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006070.4-1441s21c1
Sequence:CCGGCCCAAACTTCTCAGCCTACTACTCGAGTAGTAGGCTGAGAAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks