EMAIL THIS PAGE TO A FRIEND

TFIP11

tuftelin interacting protein 11

Synonyms: NTR1 Spp382 TIP39 bK445C9.6 hNtr1
UniProtKB ID: Q9UBB9, O95908, Q20WL0, Q5H8V8, Q9UGV7, Q9Y2Q8
Gene ID:
Human(24144) Summary: TFIP11 is a nuclear speckle-localized protein that may play a role in spliceosome disassembly in Cajal bodies (Stanek et al., 2008 [PubMed 18367544]
Mouse(54723) tuftelin interacting protein 11
Rat(288718) tuftelin interacting protein 11
Zebrafish(436994) tuftelin interacting protein 11
dog(477530) tuftelin interacting protein 11
domestic cat(101084236) tuftelin interacting protein 11
chicken(416909) tuftelin interacting protein 11
cow(509349) tuftelin interacting protein 11
sheep(101104606) tuftelin interacting protein 11
domestic guinea pig(100721652) tuftelin interacting protein 11
naked mole-rat(101715772) tuftelin interacting protein 11
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018783 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018783 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018783 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001008697 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008697 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008697 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008697 Rosetta Predictions human pricing
NM_012143 Rosetta Predictions human pricing
NM_001008291 Rosetta Predictions rat pricing
NM_018783 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008697 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221088 predicted 1654
2 SASI_Hs01_00221089 predicted 634
3 SASI_Hs01_00221090 predicted 1847
4 SASI_Hs01_00221091 predicted 606
5 SASI_Hs01_00221092 predicted 843
6 SASI_Hs01_00221093 predicted 2223
7 SASI_Hs01_00221094 predicted 824
8 SASI_Hs01_00221095 predicted 634
9 SASI_Hs01_00221096 predicted 827
10 SASI_Hs01_00221097 predicted 1657
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012143 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169613 predicted 1582
2 SASI_Hs01_00169614 predicted 551
3 SASI_Hs01_00169615 predicted 1765
4 SASI_Hs01_00169616 predicted 527
5 SASI_Hs01_00169617 predicted 762
6 SASI_Hs01_00169618 predicted 2140
7 SASI_Hs01_00169619 predicted 748
8 SASI_Hs01_00169620 predicted 552
9 SASI_Hs01_00169621 predicted 759
10 SASI_Hs01_00169622 predicted 1577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008291 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034272 predicted 962
2 SASI_Rn01_00034273 predicted 2411
3 SASI_Rn01_00034274 predicted 2821
4 SASI_Rn01_00034275 predicted 2805
5 SASI_Rn01_00034276 predicted 648
6 SASI_Rn01_00034277 predicted 669
7 SASI_Rn01_00034278 predicted 480
8 SASI_Rn01_00034279 predicted 1595
9 SASI_Rn02_00198995 predicted 389
10 SASI_Rn01_00034280 predicted 1041
11 SASI_Rn01_00034281 predicted 2086
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018783 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324093 predicted 2875
2 SASI_Mm01_00124724 predicted 2197
3 SASI_Mm02_00324094 predicted 638
4 SASI_Mm01_00124725 predicted 2409
5 SASI_Mm01_00124726 predicted 996
6 SASI_Mm02_00324095 predicted 608
7 SASI_Mm01_00124729 predicted 2307
8 SASI_Mm02_00324096 predicted 2611
9 SASI_Mm01_00124730 predicted 2836
10 SASI_Mm01_00124731 predicted 648
11 SASI_Mm01_00124722 predicted 2865
12 SASI_Mm01_00124723 predicted 520
13 SASI_Mm01_00124727 predicted 841
14 SASI_Mm01_00124728 predicted 704
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018783
TFIP11 MISSION shRNA Bacterial Glycerol Stock
tuftelin interacting protein 11
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018783.4-3227s21c1
Sequence:CCGGGAGGACCAGATACGGGCATTACTCGAGTAATGCCCGTATCTGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018783.4-1496s21c1
Sequence:CCGGATGAGTGTGCCCGCATCTTTGCTCGAGCAAAGATGCGGGCACACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018783.4-1518s21c1
Sequence:CCGGGACACTACAGGACAAGTATTACTCGAGTAATACTTGTCCTGTAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018783.4-2414s21c1
Sequence:CCGGTCAACGAAGCGCTCGACATAACTCGAGTTATGTCGAGCGCTTCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018783.4-625s21c1
Sequence:CCGGGAGGACTTCCCGAAGGATTTACTCGAGTAAATCCTTCGGGAAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018783.4-1593s21c1
Sequence:CCGGGCTCGTGAAGGACTACTTTAACTCGAGTTAAAGTAGTCCTTCACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018783.4-356s21c1
Sequence:CCGGACGATGAGAGGGAGAACTTTGCTCGAGCAAAGTTCTCCCTCTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018783.4-2603s21c1
Sequence:CCGGGCTCCGTGCCCATGAACTTTACTCGAGTAAAGTTCATGGGCACGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018783.3-2865s1c1
Sequence:CCGGGCTGATGAATAACGTCTCTATCTCGAGATAGAGACGTTATTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018783.3-633s1c1
Sequence:CCGGCCCGAAGGATTTAGGACCAAACTCGAGTTTGGTCCTAAATCCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018783.3-2310s1c1
Sequence:CCGGGCTCAGTAACAGTCCCAATTACTCGAGTAATTGGGACTGTTACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018783.3-1650s1c1
Sequence:CCGGCCAGATCATCTCCAAGTGGAACTCGAGTTCCACTTGGAGATGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018783.3-1592s1c1
Sequence:CCGGCGCTCGTGAAGGACTACTTTACTCGAGTAAAGTAGTCCTTCACGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018783
TFIP11 MISSION shRNA shRNA Plasmid DNA
tuftelin interacting protein 11
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018783.4-3227s21c1
Sequence:CCGGGAGGACCAGATACGGGCATTACTCGAGTAATGCCCGTATCTGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018783.4-1496s21c1
Sequence:CCGGATGAGTGTGCCCGCATCTTTGCTCGAGCAAAGATGCGGGCACACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018783.4-1518s21c1
Sequence:CCGGGACACTACAGGACAAGTATTACTCGAGTAATACTTGTCCTGTAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018783.4-2414s21c1
Sequence:CCGGTCAACGAAGCGCTCGACATAACTCGAGTTATGTCGAGCGCTTCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018783.4-625s21c1
Sequence:CCGGGAGGACTTCCCGAAGGATTTACTCGAGTAAATCCTTCGGGAAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018783.4-1593s21c1
Sequence:CCGGGCTCGTGAAGGACTACTTTAACTCGAGTTAAAGTAGTCCTTCACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018783.4-356s21c1
Sequence:CCGGACGATGAGAGGGAGAACTTTGCTCGAGCAAAGTTCTCCCTCTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018783.4-2603s21c1
Sequence:CCGGGCTCCGTGCCCATGAACTTTACTCGAGTAAAGTTCATGGGCACGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018783.3-2865s1c1
Sequence:CCGGGCTGATGAATAACGTCTCTATCTCGAGATAGAGACGTTATTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018783.3-633s1c1
Sequence:CCGGCCCGAAGGATTTAGGACCAAACTCGAGTTTGGTCCTAAATCCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018783.3-2310s1c1
Sequence:CCGGGCTCAGTAACAGTCCCAATTACTCGAGTAATTGGGACTGTTACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018783.3-1650s1c1
Sequence:CCGGCCAGATCATCTCCAAGTGGAACTCGAGTTCCACTTGGAGATGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018783.3-1592s1c1
Sequence:CCGGCGCTCGTGAAGGACTACTTTACTCGAGTAAAGTAGTCCTTCACGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018783
TFIP11 MISSION shRNA Lentiviral Transduction Particles
tuftelin interacting protein 11
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018783.4-3227s21c1
Sequence:CCGGGAGGACCAGATACGGGCATTACTCGAGTAATGCCCGTATCTGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018783.4-1496s21c1
Sequence:CCGGATGAGTGTGCCCGCATCTTTGCTCGAGCAAAGATGCGGGCACACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018783.4-1518s21c1
Sequence:CCGGGACACTACAGGACAAGTATTACTCGAGTAATACTTGTCCTGTAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018783.4-2414s21c1
Sequence:CCGGTCAACGAAGCGCTCGACATAACTCGAGTTATGTCGAGCGCTTCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018783.4-625s21c1
Sequence:CCGGGAGGACTTCCCGAAGGATTTACTCGAGTAAATCCTTCGGGAAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018783.4-1593s21c1
Sequence:CCGGGCTCGTGAAGGACTACTTTAACTCGAGTTAAAGTAGTCCTTCACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018783.4-356s21c1
Sequence:CCGGACGATGAGAGGGAGAACTTTGCTCGAGCAAAGTTCTCCCTCTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018783.4-2603s21c1
Sequence:CCGGGCTCCGTGCCCATGAACTTTACTCGAGTAAAGTTCATGGGCACGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018783.3-2865s1c1
Sequence:CCGGGCTGATGAATAACGTCTCTATCTCGAGATAGAGACGTTATTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018783.3-633s1c1
Sequence:CCGGCCCGAAGGATTTAGGACCAAACTCGAGTTTGGTCCTAAATCCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018783.3-2310s1c1
Sequence:CCGGGCTCAGTAACAGTCCCAATTACTCGAGTAATTGGGACTGTTACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018783.3-1650s1c1
Sequence:CCGGCCAGATCATCTCCAAGTGGAACTCGAGTTCCACTTGGAGATGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018783.3-1592s1c1
Sequence:CCGGCGCTCGTGAAGGACTACTTTACTCGAGTAAAGTAGTCCTTCACGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008697
VALIDATED
TFIP11 MISSION shRNA Bacterial Glycerol Stock
tuftelin interacting protein 11
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000222541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008697.1-637s1c2
Sequence:CCGGCCTGTTAAGCAGGACGACTTTCTCGAGAAAGTCGTCCTGCTTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008697.1-1876s21c1
Sequence:CCGGGTGTGGATCTTAGATAACATACTCGAGTATGTTATCTAAGATCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008697.1-2376s21c1
Sequence:CCGGCCTGGGTTGGAAGTCGATGTTCTCGAGAACATCGACTTCCAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008697.1-1674s21c1
Sequence:CCGGCGAGATCATCTCTAAGTGGAACTCGAGTTCCACTTAGAGATGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008697.1-836s21c1
Sequence:CCGGAGAATGCACAAGGTATCATTACTCGAGTAATGATACCTTGTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001008697.1-1674s1c1
Sequence:CCGGCGAGATCATCTCTAAGTGGAACTCGAGTTCCACTTAGAGATGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001008697.1-1876s1c1
Sequence:CCGGGTGTGGATCTTAGATAACATACTCGAGTATGTTATCTAAGATCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001008697.1-2376s1c1
Sequence:CCGGCCTGGGTTGGAAGTCGATGTTCTCGAGAACATCGACTTCCAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008697
VALIDATED
TFIP11 MISSION shRNA shRNA Plasmid DNA
tuftelin interacting protein 11
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000222541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008697.1-637s1c2
Sequence:CCGGCCTGTTAAGCAGGACGACTTTCTCGAGAAAGTCGTCCTGCTTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008697.1-1876s21c1
Sequence:CCGGGTGTGGATCTTAGATAACATACTCGAGTATGTTATCTAAGATCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008697.1-2376s21c1
Sequence:CCGGCCTGGGTTGGAAGTCGATGTTCTCGAGAACATCGACTTCCAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008697.1-1674s21c1
Sequence:CCGGCGAGATCATCTCTAAGTGGAACTCGAGTTCCACTTAGAGATGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008697.1-836s21c1
Sequence:CCGGAGAATGCACAAGGTATCATTACTCGAGTAATGATACCTTGTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001008697.1-1674s1c1
Sequence:CCGGCGAGATCATCTCTAAGTGGAACTCGAGTTCCACTTAGAGATGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001008697.1-1876s1c1
Sequence:CCGGGTGTGGATCTTAGATAACATACTCGAGTATGTTATCTAAGATCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001008697.1-2376s1c1
Sequence:CCGGCCTGGGTTGGAAGTCGATGTTCTCGAGAACATCGACTTCCAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008697
VALIDATED
TFIP11 MISSION shRNA Lentiviral Transduction Particles
tuftelin interacting protein 11
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000222541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008697.1-637s1c2
Sequence:CCGGCCTGTTAAGCAGGACGACTTTCTCGAGAAAGTCGTCCTGCTTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008697.1-1876s21c1
Sequence:CCGGGTGTGGATCTTAGATAACATACTCGAGTATGTTATCTAAGATCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008697.1-2376s21c1
Sequence:CCGGCCTGGGTTGGAAGTCGATGTTCTCGAGAACATCGACTTCCAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008697.1-1674s21c1
Sequence:CCGGCGAGATCATCTCTAAGTGGAACTCGAGTTCCACTTAGAGATGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008697.1-836s21c1
Sequence:CCGGAGAATGCACAAGGTATCATTACTCGAGTAATGATACCTTGTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001008697.1-1674s1c1
Sequence:CCGGCGAGATCATCTCTAAGTGGAACTCGAGTTCCACTTAGAGATGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001008697.1-1876s1c1
Sequence:CCGGGTGTGGATCTTAGATAACATACTCGAGTATGTTATCTAAGATCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001008697.1-2376s1c1
Sequence:CCGGCCTGGGTTGGAAGTCGATGTTCTCGAGAACATCGACTTCCAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks