EMAIL THIS PAGE TO A FRIEND

TFPI2

tissue factor pathway inhibitor 2

Synonyms: PP5 REF1 TFPI-2
UniProtKB ID: P48307, Q66ME8, Q9UC86
Gene ID:
Human(7980) Summary: This gene encodes a member of the Kunitz-type serine proteinase inhibitor family. The protein can inhibit a variety of serine proteases including factor VIIa/tissue factor, factor Xa, plasmin, trypsin, chymotryspin and plasma kallikrein. This gene has been identified as a tumor suppressor gene in several types of cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Mouse(21789) tissue factor pathway inhibitor 2
Rat(286926) tissue factor pathway inhibitor 2
cow(360007) tissue factor pathway inhibitor 2
sheep(101113838) tissue factor pathway inhibitor 2
naked mole-rat(101719683) tissue factor pathway inhibitor 2
Zebrafish(560339) tissue factor pathway inhibitor 2
chicken(420561) tissue factor pathway inhibitor 2
domestic cat(101088228) tissue factor pathway inhibitor 2
dog(475230) tissue factor pathway inhibitor 2
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1739 Human TFPI-2 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006528 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006528 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006528 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009364 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009364 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009364 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU015741 MISSION® esiRNA esiRNA targeting human TFPI2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006528 Rosetta Predictions human pricing
NM_173141 Rosetta Predictions rat pricing
NM_009364 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006528 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169243 predicted 226
2 SASI_Hs01_00169244 predicted 613
3 SASI_Hs01_00169245 predicted 572
4 SASI_Hs01_00169246 predicted 347
5 SASI_Hs01_00169247 predicted 788
6 SASI_Hs01_00169248 predicted 642
7 SASI_Hs01_00169249 predicted 809
8 SASI_Hs01_00169250 predicted 944
9 SASI_Hs01_00169251 predicted 824
10 SASI_Hs02_00341765 predicted 325
11 SASI_Hs01_00169252 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173141 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086061 predicted 362
2 SASI_Rn01_00086062 predicted 277
3 SASI_Rn02_00269319 predicted 356
4 SASI_Rn01_00086065 predicted 266
5 SASI_Rn01_00086068 predicted 730
6 SASI_Rn01_00086069 predicted 876
7 SASI_Rn01_00086070 predicted 216
8 SASI_Rn02_00269320 predicted 411
9 SASI_Rn02_00269321 predicted 333
10 SASI_Rn02_00269322 predicted 542
11 SASI_Rn01_00086063 predicted 767
12 SASI_Rn01_00086064 predicted 315
13 SASI_Rn01_00086066 predicted 733
14 SASI_Rn01_00086067 predicted 901
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009364 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315966 predicted 1146
2 SASI_Mm01_00112047 predicted 1111
3 SASI_Mm01_00112048 predicted 1044
4 SASI_Mm02_00315967 predicted 1016
5 SASI_Mm02_00315968 predicted 1166
6 SASI_Mm02_00315969 predicted 1046
7 SASI_Mm02_00315970 predicted 1015
8 SASI_Mm01_00112049 predicted 274
9 SASI_Mm02_00315971 predicted 306
10 SASI_Mm02_00315972 predicted 274
11 SASI_Mm01_00112044 predicted 603
12 SASI_Mm01_00112045 predicted 1212
13 SASI_Mm01_00112046 predicted 1200
14 SASI_Mm01_00112050 predicted 220
15 SASI_Mm01_00112051 predicted 484
16 SASI_Mm01_00112052 predicted 332
17 SASI_Mm01_00112053 predicted 381
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006528
VALIDATED
TFPI2 MISSION shRNA Bacterial Glycerol Stock
tissue factor pathway inhibitor 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006528.2-1014s21c1
Sequence:CCGGTTCTTGCAATGCATAAGATATCTCGAGATATCTTATGCATTGCAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373822    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006528.2-945s21c1
Sequence:CCGGATAACTAGCTGCTATTCAAATCTCGAGATTTGAATAGCAGCTAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_006528.2-620s1c1
Sequence:CCGGCCTGTGATGCTTTCACCTATACTCGAGTATAGGTGAAAGCATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006528.2-578s1c1
Sequence:CCGGCTGCCAATGTGACTCGCTATTCTCGAGAATAGCGAGTCACATTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_006528.2-735s1c1
Sequence:CCGGGCTTCGCTTTGCCAGTAGAATCTCGAGATTCTACTGGCAAAGCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_006528.2-581s1c1
Sequence:CCGGCCAATGTGACTCGCTATTATTCTCGAGAATAATAGCGAGTCACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006528.2-826s1c1
Sequence:CCGGGCCTTTATGGTTGTATCTGAACTCGAGTTCAGATACAACCATAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006528
VALIDATED
TFPI2 MISSION shRNA shRNA Plasmid DNA
tissue factor pathway inhibitor 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006528.2-1014s21c1
Sequence:CCGGTTCTTGCAATGCATAAGATATCTCGAGATATCTTATGCATTGCAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373822    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006528.2-945s21c1
Sequence:CCGGATAACTAGCTGCTATTCAAATCTCGAGATTTGAATAGCAGCTAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_006528.2-620s1c1
Sequence:CCGGCCTGTGATGCTTTCACCTATACTCGAGTATAGGTGAAAGCATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006528.2-578s1c1
Sequence:CCGGCTGCCAATGTGACTCGCTATTCTCGAGAATAGCGAGTCACATTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_006528.2-735s1c1
Sequence:CCGGGCTTCGCTTTGCCAGTAGAATCTCGAGATTCTACTGGCAAAGCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_006528.2-581s1c1
Sequence:CCGGCCAATGTGACTCGCTATTATTCTCGAGAATAATAGCGAGTCACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006528.2-826s1c1
Sequence:CCGGGCCTTTATGGTTGTATCTGAACTCGAGTTCAGATACAACCATAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006528
VALIDATED
TFPI2 MISSION shRNA Lentiviral Transduction Particles
tissue factor pathway inhibitor 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006528.2-1014s21c1
Sequence:CCGGTTCTTGCAATGCATAAGATATCTCGAGATATCTTATGCATTGCAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373822    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006528.2-945s21c1
Sequence:CCGGATAACTAGCTGCTATTCAAATCTCGAGATTTGAATAGCAGCTAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_006528.2-620s1c1
Sequence:CCGGCCTGTGATGCTTTCACCTATACTCGAGTATAGGTGAAAGCATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006528.2-578s1c1
Sequence:CCGGCTGCCAATGTGACTCGCTATTCTCGAGAATAGCGAGTCACATTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_006528.2-735s1c1
Sequence:CCGGGCTTCGCTTTGCCAGTAGAATCTCGAGATTCTACTGGCAAAGCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_006528.2-581s1c1
Sequence:CCGGCCAATGTGACTCGCTATTATTCTCGAGAATAATAGCGAGTCACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006528.2-826s1c1
Sequence:CCGGGCCTTTATGGTTGTATCTGAACTCGAGTTCAGATACAACCATAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009364
VALIDATED
TFPI2 MISSION shRNA Bacterial Glycerol Stock
tissue factor pathway inhibitor 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000271824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009364.3-570s21c1
Sequence:CCGGATGTGAGACTTTCACCTATACCTCGAGGTATAGGTGAAAGTCTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009364.3-935s21c1
Sequence:CCGGTGGGATAGCTAGTACTAATTTCTCGAGAAATTAGTACTAGCTATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009364.3-209s21c1
Sequence:CCGGAGTGCCGCAGATTCAACTATGCTCGAGCATAGTTGAATCTGCGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009364.3-411s21c1
Sequence:CCGGTCTGTGTAGCAGGACTATAAACTCGAGTTTATAGTCCTGCTACACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009364.3-237s21c1
Sequence:CCGGCTTGGGCAATGCCAACAATTTCTCGAGAAATTGTTGGCATTGCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009364.2-862s1c1
Sequence:CCGGGCCTTCCAAATGTGAAATTATCTCGAGATAATTTCACATTTGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009364.2-374s1c1
Sequence:CCGGTCCATGTGATAAGCCCAATATCTCGAGATATTGGGCTTATCACATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009364.2-311s1c1
Sequence:CCGGCCAACAGACTTGCGGAAGTATCTCGAGATACTTCCGCAAGTCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009364.2-149s1c1
Sequence:CCGGCCAAGGGAATAATTTAGAGATCTCGAGATCTCTAAATTATTCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009364.2-375s1c1
Sequence:CCGGCCATGTGATAAGCCCAATATACTCGAGTATATTGGGCTTATCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009364
VALIDATED
TFPI2 MISSION shRNA shRNA Plasmid DNA
tissue factor pathway inhibitor 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000271824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009364.3-570s21c1
Sequence:CCGGATGTGAGACTTTCACCTATACCTCGAGGTATAGGTGAAAGTCTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009364.3-935s21c1
Sequence:CCGGTGGGATAGCTAGTACTAATTTCTCGAGAAATTAGTACTAGCTATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009364.3-209s21c1
Sequence:CCGGAGTGCCGCAGATTCAACTATGCTCGAGCATAGTTGAATCTGCGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009364.3-411s21c1
Sequence:CCGGTCTGTGTAGCAGGACTATAAACTCGAGTTTATAGTCCTGCTACACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009364.3-237s21c1
Sequence:CCGGCTTGGGCAATGCCAACAATTTCTCGAGAAATTGTTGGCATTGCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009364.2-862s1c1
Sequence:CCGGGCCTTCCAAATGTGAAATTATCTCGAGATAATTTCACATTTGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009364.2-374s1c1
Sequence:CCGGTCCATGTGATAAGCCCAATATCTCGAGATATTGGGCTTATCACATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009364.2-311s1c1
Sequence:CCGGCCAACAGACTTGCGGAAGTATCTCGAGATACTTCCGCAAGTCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009364.2-149s1c1
Sequence:CCGGCCAAGGGAATAATTTAGAGATCTCGAGATCTCTAAATTATTCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009364.2-375s1c1
Sequence:CCGGCCATGTGATAAGCCCAATATACTCGAGTATATTGGGCTTATCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009364
VALIDATED
TFPI2 MISSION shRNA Lentiviral Transduction Particles
tissue factor pathway inhibitor 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000271824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009364.3-570s21c1
Sequence:CCGGATGTGAGACTTTCACCTATACCTCGAGGTATAGGTGAAAGTCTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009364.3-935s21c1
Sequence:CCGGTGGGATAGCTAGTACTAATTTCTCGAGAAATTAGTACTAGCTATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009364.3-209s21c1
Sequence:CCGGAGTGCCGCAGATTCAACTATGCTCGAGCATAGTTGAATCTGCGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009364.3-411s21c1
Sequence:CCGGTCTGTGTAGCAGGACTATAAACTCGAGTTTATAGTCCTGCTACACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009364.3-237s21c1
Sequence:CCGGCTTGGGCAATGCCAACAATTTCTCGAGAAATTGTTGGCATTGCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009364.2-862s1c1
Sequence:CCGGGCCTTCCAAATGTGAAATTATCTCGAGATAATTTCACATTTGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009364.2-374s1c1
Sequence:CCGGTCCATGTGATAAGCCCAATATCTCGAGATATTGGGCTTATCACATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009364.2-311s1c1
Sequence:CCGGCCAACAGACTTGCGGAAGTATCTCGAGATACTTCCGCAAGTCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009364.2-149s1c1
Sequence:CCGGCCAAGGGAATAATTTAGAGATCTCGAGATCTCTAAATTATTCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009364.2-375s1c1
Sequence:CCGGCCATGTGATAAGCCCAATATACTCGAGTATATTGGGCTTATCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks