EMAIL THIS PAGE TO A FRIEND

TFPI

tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor)

Synonyms: EPI LACI TFI TFPI1
UniProtKB ID: P10646, O95103, Q53TS4
Gene ID:
Human(7035) Summary: This gene encodes a protease inhibitor that regulates the tissue factor (TF)-dependent pathway of blood coagulation. The coagulation process initiates with the formation of a factor VIIa-TF complex, which proteolytically activates additional proteases (factors IX and X) and ultimately leads to the formation of a fibrin clot. The product of this gene inhibits the activated factor X and VIIa-TF proteases in an autoregulatory loop. The encoded protein is glycosylated and predominantly found in the vascular endothelium and plasma in both free forms and complexed with plasma lipoproteins. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been confirmed. [provided by RefSeq, Jul 2008]
Mouse(21788) tissue factor pathway inhibitor
Rat(29436) tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor)
chicken(423989) tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor)
dog(403921) tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor)
domestic cat(101098813) tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor)
naked mole-rat(101710461) tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor)
Domestic Rabbit(100009401) tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor)
domestic guinea pig(100727170) tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor)
cow(508763) tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor)
sheep(101120391) tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor)
92 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011576 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011576 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011576 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006287 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006287 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006287 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001032281 Rosetta Predictions human pricing
NM_006287 Rosetta Predictions human pricing
NM_017200 Rosetta Predictions rat pricing
NM_011576 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032281 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131735 predicted 425
2 SASI_Hs01_00131736 predicted 331
3 SASI_Hs01_00131737 predicted 313
4 SASI_Hs01_00131738 predicted 518
5 SASI_Hs01_00131739 predicted 417
6 SASI_Hs01_00131740 predicted 527
7 SASI_Hs01_00131741 predicted 694
8 SASI_Hs01_00131742 predicted 603
9 SASI_Hs01_00131743 predicted 517
10 SASI_Hs01_00131744 predicted 405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006287 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195373 predicted 428
2 SASI_Hs01_00195374 predicted 331
3 SASI_Hs01_00195375 predicted 314
4 SASI_Hs01_00195376 predicted 519
5 SASI_Hs01_00195377 predicted 420
6 SASI_Hs01_00195378 predicted 522
7 SASI_Hs01_00195379 predicted 693
8 SASI_Hs01_00195380 predicted 611
9 SASI_Hs01_00195381 predicted 513
10 SASI_Hs01_00195382 predicted 404
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017200 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058338 predicted 309
2 SASI_Rn01_00058339 predicted 484
3 SASI_Rn01_00058340 predicted 389
4 SASI_Rn01_00058341 predicted 232
5 SASI_Rn01_00058342 predicted 623
6 SASI_Rn01_00058343 predicted 670
7 SASI_Rn01_00058344 predicted 490
8 SASI_Rn01_00058345 predicted 667
9 SASI_Rn01_00058346 predicted 467
10 SASI_Rn01_00058347 predicted 277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011576 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058645 predicted 1252
2 SASI_Mm01_00058646 predicted 756
3 SASI_Mm01_00058648 predicted 1086
4 SASI_Mm01_00058649 predicted 887
5 SASI_Mm01_00058650 predicted 1072
6 SASI_Mm01_00058651 predicted 578
7 SASI_Mm01_00058652 predicted 1138
8 SASI_Mm01_00058653 predicted 1218
9 SASI_Mm01_00058654 predicted 830
10 SASI_Mm02_00320968 predicted 1250
11 SASI_Mm01_00058647 predicted 1259
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011576
VALIDATED
TFPI MISSION shRNA Bacterial Glycerol Stock
tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011576.1-1336s1c1
Sequence:CCGGTCTTCTACAAACCAGTGTCTTCTCGAGAAGACACTGGTTTGTAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011576.1-725s1c1
Sequence:CCGGCCGAGGTTACATGAAGAGGTACTCGAGTACCTCTTCATGTAACCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011576.1-512s1c1
Sequence:CCGGCAAAGCAATGATAAGGAGTTACTCGAGTAACTCCTTATCATTGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011576.1-373s1c1
Sequence:CCGGCCACTGTGTGTCTGTTGCTTACTCGAGTAAGCAACAGACACACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011576.1-767s1c1
Sequence:CCGGGCAGTGTGAACGATTCGTGTACTCGAGTACACGAATCGTTCACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011576
VALIDATED
TFPI MISSION shRNA shRNA Plasmid DNA
tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011576.1-1336s1c1
Sequence:CCGGTCTTCTACAAACCAGTGTCTTCTCGAGAAGACACTGGTTTGTAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011576.1-725s1c1
Sequence:CCGGCCGAGGTTACATGAAGAGGTACTCGAGTACCTCTTCATGTAACCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011576.1-512s1c1
Sequence:CCGGCAAAGCAATGATAAGGAGTTACTCGAGTAACTCCTTATCATTGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011576.1-373s1c1
Sequence:CCGGCCACTGTGTGTCTGTTGCTTACTCGAGTAAGCAACAGACACACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011576.1-767s1c1
Sequence:CCGGGCAGTGTGAACGATTCGTGTACTCGAGTACACGAATCGTTCACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011576
VALIDATED
TFPI MISSION shRNA Lentiviral Transduction Particles
tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011576.1-1336s1c1
Sequence:CCGGTCTTCTACAAACCAGTGTCTTCTCGAGAAGACACTGGTTTGTAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011576.1-725s1c1
Sequence:CCGGCCGAGGTTACATGAAGAGGTACTCGAGTACCTCTTCATGTAACCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011576.1-512s1c1
Sequence:CCGGCAAAGCAATGATAAGGAGTTACTCGAGTAACTCCTTATCATTGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011576.1-373s1c1
Sequence:CCGGCCACTGTGTGTCTGTTGCTTACTCGAGTAAGCAACAGACACACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011576.1-767s1c1
Sequence:CCGGGCAGTGTGAACGATTCGTGTACTCGAGTACACGAATCGTTCACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006287
VALIDATED
TFPI MISSION shRNA Bacterial Glycerol Stock
tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006287.3-535s1c1
Sequence:CCGGCGAGGTTATATTACCAGGTATCTCGAGATACCTGGTAATATAACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073583    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006287.3-1188s1c1
Sequence:CCGGCGTTTGTATCAGAGTTGCTTTCTCGAGAAAGCAACTCTGATACAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006287.3-860s1c1
Sequence:CCGGGCCCATTTAAGTACAGTGGATCTCGAGATCCACTGTACTTAAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006287.3-522s1c1
Sequence:CCGGTCCTGGAATATGTCGAGGTTACTCGAGTAACCTCGACATATTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006287.3-606s1c1
Sequence:CCGGCCTGGGCAATATGAACAATTTCTCGAGAAATTGTTCATATTGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006287.4-769s21c1
Sequence:CCGGCCTGGGCAATATGAACAATTTCTCGAGAAATTGTTCATATTGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006287.4-1351s21c1
Sequence:CCGGCGTTTGTATCAGAGTTGCTTTCTCGAGAAAGCAACTCTGATACAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006287.4-685s21c1
Sequence:CCGGTCCTGGAATATGTCGAGGTTACTCGAGTAACCTCGACATATTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006287.4-698s21c1
Sequence:CCGGCGAGGTTATATTACCAGGTATCTCGAGATACCTGGTAATATAACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006287
VALIDATED
TFPI MISSION shRNA shRNA Plasmid DNA
tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006287.3-535s1c1
Sequence:CCGGCGAGGTTATATTACCAGGTATCTCGAGATACCTGGTAATATAACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073583    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006287.3-1188s1c1
Sequence:CCGGCGTTTGTATCAGAGTTGCTTTCTCGAGAAAGCAACTCTGATACAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006287.3-860s1c1
Sequence:CCGGGCCCATTTAAGTACAGTGGATCTCGAGATCCACTGTACTTAAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006287.3-522s1c1
Sequence:CCGGTCCTGGAATATGTCGAGGTTACTCGAGTAACCTCGACATATTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006287.3-606s1c1
Sequence:CCGGCCTGGGCAATATGAACAATTTCTCGAGAAATTGTTCATATTGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006287.4-769s21c1
Sequence:CCGGCCTGGGCAATATGAACAATTTCTCGAGAAATTGTTCATATTGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006287.4-1351s21c1
Sequence:CCGGCGTTTGTATCAGAGTTGCTTTCTCGAGAAAGCAACTCTGATACAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006287.4-685s21c1
Sequence:CCGGTCCTGGAATATGTCGAGGTTACTCGAGTAACCTCGACATATTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006287.4-698s21c1
Sequence:CCGGCGAGGTTATATTACCAGGTATCTCGAGATACCTGGTAATATAACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006287
VALIDATED
TFPI MISSION shRNA Lentiviral Transduction Particles
tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006287.3-535s1c1
Sequence:CCGGCGAGGTTATATTACCAGGTATCTCGAGATACCTGGTAATATAACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073583    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006287.3-1188s1c1
Sequence:CCGGCGTTTGTATCAGAGTTGCTTTCTCGAGAAAGCAACTCTGATACAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006287.3-860s1c1
Sequence:CCGGGCCCATTTAAGTACAGTGGATCTCGAGATCCACTGTACTTAAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006287.3-522s1c1
Sequence:CCGGTCCTGGAATATGTCGAGGTTACTCGAGTAACCTCGACATATTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006287.3-606s1c1
Sequence:CCGGCCTGGGCAATATGAACAATTTCTCGAGAAATTGTTCATATTGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006287.4-769s21c1
Sequence:CCGGCCTGGGCAATATGAACAATTTCTCGAGAAATTGTTCATATTGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006287.4-1351s21c1
Sequence:CCGGCGTTTGTATCAGAGTTGCTTTCTCGAGAAAGCAACTCTGATACAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006287.4-685s21c1
Sequence:CCGGTCCTGGAATATGTCGAGGTTACTCGAGTAACCTCGACATATTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006287.4-698s21c1
Sequence:CCGGCGAGGTTATATTACCAGGTATCTCGAGATACCTGGTAATATAACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks