EMAIL THIS PAGE TO A FRIEND

TFPT

TCF3 (E2A) fusion partner (in childhood Leukemia)

Synonyms: FB1 INO80F amida
UniProtKB ID: P0C1Z6
Gene ID:
Mouse(69714) TCF3 (E2A) fusion partner
Rat(85423) TCF3 (E2A) fusion partner
Zebrafish(796934) TCF3 fusion partner homolog
dog(611475) TCF3 (E2A) fusion partner (in childhood Leukemia)
domestic cat(101081177) TCF3 (E2A) fusion partner (in childhood Leukemia)
naked mole-rat(101696969) TCF3 (E2A) fusion partner (in childhood Leukemia)
Domestic Rabbit(100328775) TCF3 (E2A) fusion partner (in childhood Leukemia)
domestic guinea pig(100736185) TCF3 (E2A) fusion partner (in childhood Leukemia)
cow(506610) TCF3 (E2A) fusion partner (in childhood Leukemia)
sheep(101108076) TCF3 (E2A) fusion partner (in childhood Leukemia)
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023524 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023524 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023524 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013342 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013342 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013342 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013342 Rosetta Predictions human pricing
NM_138870 Rosetta Predictions rat pricing
NM_023524 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013342 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201307 predicted 736
2 SASI_Hs01_00201308 predicted 372
3 SASI_Hs01_00201310 predicted 744
4 SASI_Hs01_00201311 predicted 508
5 SASI_Hs01_00201312 predicted 612
6 SASI_Hs01_00201313 predicted 494
7 SASI_Hs01_00201314 predicted 580
8 SASI_Hs01_00201315 predicted 515
9 SASI_Hs01_00201316 predicted 680
10 SASI_Hs02_00344657 predicted 599
11 SASI_Hs01_00201309 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138870 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121174 predicted 367
2 SASI_Rn01_00121175 predicted 235
3 SASI_Rn01_00121176 predicted 372
4 SASI_Rn01_00121177 predicted 249
5 SASI_Rn01_00121178 predicted 260
6 SASI_Rn01_00121179 predicted 249
7 SASI_Rn01_00121180 predicted 357
8 SASI_Rn01_00121181 predicted 315
9 SASI_Rn01_00121183 predicted 201
10 SASI_Rn02_00268280 predicted 364
11 SASI_Rn01_00121182 predicted 249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023524 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061366 predicted 530
2 SASI_Mm01_00061367 predicted 709
3 SASI_Mm01_00061370 predicted 780
4 SASI_Mm01_00061371 predicted 393
5 SASI_Mm02_00327164 predicted 618
6 SASI_Mm01_00061372 predicted 596
7 SASI_Mm01_00061373 predicted 588
8 SASI_Mm02_00327165 predicted 700
9 SASI_Mm01_00061374 predicted 538
10 SASI_Mm01_00061375 predicted 626
11 SASI_Mm01_00061368 predicted 427
12 SASI_Mm01_00061369 predicted 702
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023524
VALIDATED
TFPT MISSION shRNA Bacterial Glycerol Stock
TCF3 (E2A) fusion partner (in childhood Leukemia)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023524.1-628s1c1
Sequence:CCGGGCAAAGGATAACTCGGAGACTCTCGAGAGTCTCCGAGTTATCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023524.1-779s1c1
Sequence:CCGGGAGAATGAACCTCCAGAGAAACTCGAGTTTCTCTGGAGGTTCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023524.1-440s1c1
Sequence:CCGGGAAGTGGAATTTGTGTCCGGTCTCGAGACCGGACACAAATTCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023524.1-817s1c1
Sequence:CCGGCCAAAGGACAACTGCAACCTTCTCGAGAAGGTTGCAGTTGTCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023524.1-545s1c1
Sequence:CCGGCGTAGAAAGTACCAGGCACTACTCGAGTAGTGCCTGGTACTTTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200036    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023524.1-704s1c1
Sequence:CCGGCGAGATAGCCAGTTCACCATTCTCGAGAATGGTGAACTGGCTATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023524.1-628s21c1
Sequence:CCGGGCAAAGGATAACTCGGAGACTCTCGAGAGTCTCCGAGTTATCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023524.1-817s21c1
Sequence:CCGGCCAAAGGACAACTGCAACCTTCTCGAGAAGGTTGCAGTTGTCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023524.1-406s21c1
Sequence:CCGGTGGTGGCCACATCCTAGAAAGCTCGAGCTTTCTAGGATGTGGCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023524.1-440s21c1
Sequence:CCGGGAAGTGGAATTTGTGTCCGGTCTCGAGACCGGACACAAATTCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023524.1-545s21c1
Sequence:CCGGCGTAGAAAGTACCAGGCACTACTCGAGTAGTGCCTGGTACTTTCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023524
VALIDATED
TFPT MISSION shRNA shRNA Plasmid DNA
TCF3 (E2A) fusion partner (in childhood Leukemia)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023524.1-628s1c1
Sequence:CCGGGCAAAGGATAACTCGGAGACTCTCGAGAGTCTCCGAGTTATCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023524.1-779s1c1
Sequence:CCGGGAGAATGAACCTCCAGAGAAACTCGAGTTTCTCTGGAGGTTCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023524.1-440s1c1
Sequence:CCGGGAAGTGGAATTTGTGTCCGGTCTCGAGACCGGACACAAATTCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023524.1-817s1c1
Sequence:CCGGCCAAAGGACAACTGCAACCTTCTCGAGAAGGTTGCAGTTGTCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023524.1-545s1c1
Sequence:CCGGCGTAGAAAGTACCAGGCACTACTCGAGTAGTGCCTGGTACTTTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200036    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023524.1-704s1c1
Sequence:CCGGCGAGATAGCCAGTTCACCATTCTCGAGAATGGTGAACTGGCTATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023524.1-628s21c1
Sequence:CCGGGCAAAGGATAACTCGGAGACTCTCGAGAGTCTCCGAGTTATCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023524.1-817s21c1
Sequence:CCGGCCAAAGGACAACTGCAACCTTCTCGAGAAGGTTGCAGTTGTCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023524.1-406s21c1
Sequence:CCGGTGGTGGCCACATCCTAGAAAGCTCGAGCTTTCTAGGATGTGGCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023524.1-440s21c1
Sequence:CCGGGAAGTGGAATTTGTGTCCGGTCTCGAGACCGGACACAAATTCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023524.1-545s21c1
Sequence:CCGGCGTAGAAAGTACCAGGCACTACTCGAGTAGTGCCTGGTACTTTCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023524
VALIDATED
TFPT MISSION shRNA Lentiviral Transduction Particles
TCF3 (E2A) fusion partner (in childhood Leukemia)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023524.1-628s1c1
Sequence:CCGGGCAAAGGATAACTCGGAGACTCTCGAGAGTCTCCGAGTTATCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023524.1-779s1c1
Sequence:CCGGGAGAATGAACCTCCAGAGAAACTCGAGTTTCTCTGGAGGTTCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023524.1-440s1c1
Sequence:CCGGGAAGTGGAATTTGTGTCCGGTCTCGAGACCGGACACAAATTCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023524.1-817s1c1
Sequence:CCGGCCAAAGGACAACTGCAACCTTCTCGAGAAGGTTGCAGTTGTCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023524.1-545s1c1
Sequence:CCGGCGTAGAAAGTACCAGGCACTACTCGAGTAGTGCCTGGTACTTTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200036    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023524.1-704s1c1
Sequence:CCGGCGAGATAGCCAGTTCACCATTCTCGAGAATGGTGAACTGGCTATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023524.1-628s21c1
Sequence:CCGGGCAAAGGATAACTCGGAGACTCTCGAGAGTCTCCGAGTTATCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023524.1-817s21c1
Sequence:CCGGCCAAAGGACAACTGCAACCTTCTCGAGAAGGTTGCAGTTGTCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023524.1-406s21c1
Sequence:CCGGTGGTGGCCACATCCTAGAAAGCTCGAGCTTTCTAGGATGTGGCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023524.1-440s21c1
Sequence:CCGGGAAGTGGAATTTGTGTCCGGTCTCGAGACCGGACACAAATTCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023524.1-545s21c1
Sequence:CCGGCGTAGAAAGTACCAGGCACTACTCGAGTAGTGCCTGGTACTTTCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013342
TFPT MISSION shRNA Bacterial Glycerol Stock
TCF3 (E2A) fusion partner (in childhood Leukemia)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013342.1-514s1c1
Sequence:CCGGCGCAGAAAGTACCAGGCACTACTCGAGTAGTGCCTGGTACTTTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013342.2-502s21c1
Sequence:CCGGCGGGAATTAAATCGCAGAAAGCTCGAGCTTTCTGCGATTTAATTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013342.2-748s21c1
Sequence:CCGGGAGAATGAGCCTCCAGAGAAACTCGAGTTTCTCTGGAGGCTCATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013342.2-400s21c1
Sequence:CCGGCTGGAGACGGAAGTGGAGTTTCTCGAGAAACTCCACTTCCGTCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013342.2-640s21c1
Sequence:CCGGATGAGAGTGCTGGACTCCTACCTCGAGGTAGGAGTCCAGCACTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013342.2-587s21c1
Sequence:CCGGTCCATCAGGTGCAGAGGATAACTCGAGTTATCCTCTGCACCTGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013342
TFPT MISSION shRNA shRNA Plasmid DNA
TCF3 (E2A) fusion partner (in childhood Leukemia)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013342.1-514s1c1
Sequence:CCGGCGCAGAAAGTACCAGGCACTACTCGAGTAGTGCCTGGTACTTTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013342.2-502s21c1
Sequence:CCGGCGGGAATTAAATCGCAGAAAGCTCGAGCTTTCTGCGATTTAATTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013342.2-748s21c1
Sequence:CCGGGAGAATGAGCCTCCAGAGAAACTCGAGTTTCTCTGGAGGCTCATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013342.2-400s21c1
Sequence:CCGGCTGGAGACGGAAGTGGAGTTTCTCGAGAAACTCCACTTCCGTCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013342.2-640s21c1
Sequence:CCGGATGAGAGTGCTGGACTCCTACCTCGAGGTAGGAGTCCAGCACTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013342.2-587s21c1
Sequence:CCGGTCCATCAGGTGCAGAGGATAACTCGAGTTATCCTCTGCACCTGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013342
TFPT MISSION shRNA Lentiviral Transduction Particles
TCF3 (E2A) fusion partner (in childhood Leukemia)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013342.1-514s1c1
Sequence:CCGGCGCAGAAAGTACCAGGCACTACTCGAGTAGTGCCTGGTACTTTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013342.2-502s21c1
Sequence:CCGGCGGGAATTAAATCGCAGAAAGCTCGAGCTTTCTGCGATTTAATTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013342.2-748s21c1
Sequence:CCGGGAGAATGAGCCTCCAGAGAAACTCGAGTTTCTCTGGAGGCTCATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013342.2-400s21c1
Sequence:CCGGCTGGAGACGGAAGTGGAGTTTCTCGAGAAACTCCACTTCCGTCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013342.2-640s21c1
Sequence:CCGGATGAGAGTGCTGGACTCCTACCTCGAGGTAGGAGTCCAGCACTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013342.2-587s21c1
Sequence:CCGGTCCATCAGGTGCAGAGGATAACTCGAGTTATCCTCTGCACCTGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks