EMAIL THIS PAGE TO A FRIEND

TFR2

transferrin receptor 2

Synonyms: HFE3 TFRC2
UniProtKB ID: Q9UP52, A6NGM7, O75422, Q1HE13, Q9HA99, Q9NX67
Gene ID:
Human(7036) Summary: This gene encodes a single-pass type II membrane protein, which is a member of the transferrin receptor-like family. This protein mediates cellular uptake of transferrin-bound iron, and may be involved in iron metabolism, hepatocyte function and erythrocyte differentiation. Mutations in this gene have been associated with hereditary hemochromatosis type III. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, May 2011]
Mouse(50765) transferrin receptor 2
Rat(288562) transferrin receptor 2
Zebrafish(494476) transferrin receptor 2
Horse(100067467) transferrin receptor 2
domestic cat(101092657) transferrin receptor 2
dog(489834) transferrin receptor 2
cow(617916) transferrin receptor 2
sheep(101103367) transferrin receptor 2
domestic guinea pig(100712922) transferrin receptor 2
Domestic Rabbit(100357314) transferrin receptor 2
naked mole-rat(101712680) transferrin receptor 2
Gene Class: Dehydratase
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003227 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003227 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003227 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015799 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015799 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015799 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU066351 MISSION® esiRNA esiRNA targeting mouse Trfr2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003227 Rosetta Predictions human pricing
NM_001105916 Rosetta Predictions rat pricing
NM_015799 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003227 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083087 predicted 2145
2 SASI_Hs01_00083088 predicted 2145
3 SASI_Hs01_00083090 predicted 408
4 SASI_Hs01_00083091 predicted 1744
5 SASI_Hs01_00083092 predicted 2161
6 SASI_Hs01_00083093 predicted 985
7 SASI_Hs02_00335267 predicted 2159
8 SASI_Hs01_00083094 predicted 2424
9 SASI_Hs01_00083095 predicted 1836
10 SASI_Hs01_00083096 predicted 1834
11 SASI_Hs01_00083089 predicted 2534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105916 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213802 predicted 1885
2 SASI_Rn02_00213803 predicted 524
3 SASI_Rn02_00213804 predicted 1563
4 SASI_Rn02_00213805 predicted 2301
5 SASI_Rn02_00213806 predicted 997
6 SASI_Rn02_00213807 predicted 1665
7 SASI_Rn02_00213808 predicted 857
8 SASI_Rn02_00213809 predicted 1975
9 SASI_Rn02_00213810 predicted 753
10 SASI_Rn02_00213811 predicted 1435
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015799 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127037 predicted 2347
2 SASI_Mm01_00127038 predicted 1018
3 SASI_Mm01_00127039 predicted 956
4 SASI_Mm02_00323169 predicted 2233
5 SASI_Mm01_00127041 predicted 2173
6 SASI_Mm01_00127042 predicted 815
7 SASI_Mm01_00127043 predicted 1016
8 SASI_Mm01_00127044 predicted 1522
9 SASI_Mm01_00127045 predicted 2514
10 SASI_Mm01_00127046 predicted 1083
11 SASI_Mm01_00127040 predicted 2626
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003227
TFR2 MISSION shRNA Bacterial Glycerol Stock
transferrin receptor 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003227.3-394s21c1
Sequence:CCGGTCAGTGAGGATGTCAACTATGCTCGAGCATAGTTGACATCCTCACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003227.2-1293s1c1
Sequence:CCGGGCCAGATCACTACGTTGTCATCTCGAGATGACAACGTAGTGATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003227.2-1257s1c1
Sequence:CCGGCAACAACATCTTCGGCTGCATCTCGAGATGCAGCCGAAGATGTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003227.2-2138s1c1
Sequence:CCGGGCATGTACAACGTGCGCATAACTCGAGTTATGCGCACGTTGTACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003227.2-544s1c1
Sequence:CCGGGCCGCTCTGACTCAGGACATTCTCGAGAATGTCCTGAGTCAGAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003227.2-1806s1c1
Sequence:CCGGCTACCCATTCCTGCACACAAACTCGAGTTTGTGTGCAGGAATGGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003227
TFR2 MISSION shRNA shRNA Plasmid DNA
transferrin receptor 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003227.3-394s21c1
Sequence:CCGGTCAGTGAGGATGTCAACTATGCTCGAGCATAGTTGACATCCTCACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003227.2-1293s1c1
Sequence:CCGGGCCAGATCACTACGTTGTCATCTCGAGATGACAACGTAGTGATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003227.2-1257s1c1
Sequence:CCGGCAACAACATCTTCGGCTGCATCTCGAGATGCAGCCGAAGATGTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003227.2-2138s1c1
Sequence:CCGGGCATGTACAACGTGCGCATAACTCGAGTTATGCGCACGTTGTACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003227.2-544s1c1
Sequence:CCGGGCCGCTCTGACTCAGGACATTCTCGAGAATGTCCTGAGTCAGAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003227.2-1806s1c1
Sequence:CCGGCTACCCATTCCTGCACACAAACTCGAGTTTGTGTGCAGGAATGGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003227
TFR2 MISSION shRNA Lentiviral Transduction Particles
transferrin receptor 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003227.3-394s21c1
Sequence:CCGGTCAGTGAGGATGTCAACTATGCTCGAGCATAGTTGACATCCTCACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003227.2-1293s1c1
Sequence:CCGGGCCAGATCACTACGTTGTCATCTCGAGATGACAACGTAGTGATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003227.2-1257s1c1
Sequence:CCGGCAACAACATCTTCGGCTGCATCTCGAGATGCAGCCGAAGATGTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003227.2-2138s1c1
Sequence:CCGGGCATGTACAACGTGCGCATAACTCGAGTTATGCGCACGTTGTACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003227.2-544s1c1
Sequence:CCGGGCCGCTCTGACTCAGGACATTCTCGAGAATGTCCTGAGTCAGAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003227.2-1806s1c1
Sequence:CCGGCTACCCATTCCTGCACACAAACTCGAGTTTGTGTGCAGGAATGGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015799
TFR2 MISSION shRNA Bacterial Glycerol Stock
transferrin receptor 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015799.2-1456s1c1
Sequence:CCGGCCAGATCACTATGTTGTCATTCTCGAGAATGACAACATAGTGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015799.2-613s1c1
Sequence:CCGGGCCATGTTTCTCCGGTTCCTTCTCGAGAAGGAACCGGAGAAACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015799.2-1279s1c1
Sequence:CCGGGCTGATCAATTGCTCAGGAAACTCGAGTTTCCTGAGCAATTGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015799.2-1770s1c1
Sequence:CCGGCCTCATTGAGAATATCTTGAACTCGAGTTCAAGATATTCTCAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015799.2-1008s1c1
Sequence:CCGGGCGAGTTGGAATTACTAGCTTCTCGAGAAGCTAGTAATTCCAACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015799
TFR2 MISSION shRNA shRNA Plasmid DNA
transferrin receptor 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015799.2-1456s1c1
Sequence:CCGGCCAGATCACTATGTTGTCATTCTCGAGAATGACAACATAGTGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015799.2-613s1c1
Sequence:CCGGGCCATGTTTCTCCGGTTCCTTCTCGAGAAGGAACCGGAGAAACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015799.2-1279s1c1
Sequence:CCGGGCTGATCAATTGCTCAGGAAACTCGAGTTTCCTGAGCAATTGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015799.2-1770s1c1
Sequence:CCGGCCTCATTGAGAATATCTTGAACTCGAGTTCAAGATATTCTCAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015799.2-1008s1c1
Sequence:CCGGGCGAGTTGGAATTACTAGCTTCTCGAGAAGCTAGTAATTCCAACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015799
TFR2 MISSION shRNA Lentiviral Transduction Particles
transferrin receptor 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015799.2-1456s1c1
Sequence:CCGGCCAGATCACTATGTTGTCATTCTCGAGAATGACAACATAGTGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015799.2-613s1c1
Sequence:CCGGGCCATGTTTCTCCGGTTCCTTCTCGAGAAGGAACCGGAGAAACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015799.2-1279s1c1
Sequence:CCGGGCTGATCAATTGCTCAGGAAACTCGAGTTTCCTGAGCAATTGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015799.2-1770s1c1
Sequence:CCGGCCTCATTGAGAATATCTTGAACTCGAGTTCAAGATATTCTCAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015799.2-1008s1c1
Sequence:CCGGGCGAGTTGGAATTACTAGCTTCTCGAGAAGCTAGTAATTCCAACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks