EMAIL THIS PAGE TO A FRIEND

TFRC

transferrin receptor (p90, CD71)

Synonyms: CD71 T9 TFR TFR1 TR TRFR p90
Gene ID:
Mouse(22042) transferrin receptor
Rat(64678) transferrin receptor
naked mole-rat(100913079) transferrin receptor (p90, CD71)
cow(504698) transferrin receptor (p90, CD71)
sheep(100885768) transferrin receptor (p90, CD71)
chicken(396191) transferrin receptor (p90, CD71)
Horse(100034089) transferrin receptor (p90, CD71)
domestic cat(493880) transferrin receptor (p90, CD71)
dog(403703) transferrin receptor (p90, CD71)
156 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306490 ANTI-CD71(C-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
SAB4501837 Anti-CD71, N-Terminal antibody produced in rabbit affinity isolated antibody mouse, human
pricing
SAB4504139 Anti-phospho-CD71/TfR (pSer24) antibody produced in rabbit affinity isolated antibody rat, human, mouse
pricing
SAB2502166 Anti-TFRC (N-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, pig, rat, human, mouse, bovine
ELISA, western blot pricing
HPA028598 Anti-TFRC antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4200398 Anti-TFRC antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human, mouse, rat
immunofluorescence, western blot pricing
SAB4700515 Monoclonal Anti-CD71 antibody produced in mouse clone MEM-75, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700520 Monoclonal Anti-CD71 antibody produced in mouse clone MEM-189, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700516 Monoclonal Anti-CD71-APC antibody produced in mouse clone MEM-75, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700517 Monoclonal Anti-CD71-Biotin antibody produced in mouse clone MEM-75, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700518 Monoclonal Anti-CD71-FITC antibody produced in mouse clone MEM-75, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700519 Monoclonal Anti-CD71-PE antibody produced in mouse clone MEM-75, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB1402945 Monoclonal Anti-TFRC antibody produced in mouse clone 1E6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB1740 Human TfR ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011638 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011638 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011638 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003234 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003234 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003234 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001128148 Rosetta Predictions human pricing
NM_003234 siRNAs that have been validated in the lab human pricing
XM_001072774 Rosetta Predictions rat pricing
XM_340999 Rosetta Predictions rat pricing
NM_011638 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128148 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330586 predicted 562
2 SASI_Hs02_00330587 predicted 1688
3 SASI_Hs02_00330588 predicted 247
4 SASI_Hs02_00330589 predicted 1853
5 SASI_Hs02_00330590 predicted 1215
6 SASI_Hs02_00330591 predicted 822
7 SASI_Hs02_00330592 predicted 2058
8 SASI_Hs02_00330593 predicted 1575
9 SASI_Hs02_00330594 predicted 964
10 SASI_Hs02_00330595 predicted 1551
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003234 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059217 validated 1977
1 SASI_Hs01_00059218 validated 1335
1 SASI_Hs01_00059216 validated 1807
2 SASI_Hs02_00335268 predicted 367
3 SASI_Hs01_00059219 predicted 944
4 SASI_Hs01_00059220 predicted 267
5 SASI_Hs01_00059221 predicted 2176
6 SASI_Hs01_00059222 predicted 1692
7 SASI_Hs01_00059223 predicted 1088
8 SASI_Hs01_00059224 predicted 1669
9 SASI_Hs01_00059225 predicted 2221
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072774 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00340447 predicted 785
2 SASI_Rn02_00340448 predicted 2051
3 SASI_Rn02_00340449 predicted 732
4 SASI_Rn02_00340450 predicted 1730
5 SASI_Rn02_00340451 predicted 1816
6 SASI_Rn02_00340452 predicted 931
7 SASI_Rn02_00340453 predicted 880
8 SASI_Rn02_00340454 predicted 1981
9 SASI_Rn02_00340455 predicted 2439
10 SASI_Rn02_00340456 predicted 1125
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340999 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392240 predicted 777
2 SASI_Rn02_00392241 predicted 2054
3 SASI_Rn02_00392242 predicted 732
4 SASI_Rn02_00392243 predicted 1729
5 SASI_Rn02_00392244 predicted 1816
6 SASI_Rn02_00392245 predicted 940
7 SASI_Rn02_00392246 predicted 883
8 SASI_Rn02_00392247 predicted 1980
9 SASI_Rn02_00392248 predicted 2448
10 SASI_Rn02_00392249 predicted 1118
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011638 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122815 predicted 698
2 SASI_Mm02_00321091 predicted 2058
3 SASI_Mm01_00122816 predicted 2368
4 SASI_Mm02_00321092 predicted 1655
5 SASI_Mm01_00122818 predicted 1742
6 SASI_Mm01_00122819 predicted 2381
7 SASI_Mm01_00122820 predicted 1768
8 SASI_Mm01_00122822 predicted 1732
9 SASI_Mm01_00122823 predicted 656
10 SASI_Mm01_00122824 predicted 1755
11 SASI_Mm01_00122817 predicted 2290
12 SASI_Mm01_00122821 predicted 312
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011638
VALIDATED
TFRC MISSION shRNA Bacterial Glycerol Stock
transferrin receptor (p90, CD71)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011638.3-2087s1c1
Sequence:CCGGCGTATTATGAAAGTGGAGTATCTCGAGATACTCCACTTTCATAATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011638.3-192s1c1
Sequence:CCGGCCGACAATAACATGAAGGCTACTCGAGTAGCCTTCATGTTATTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011638.3-1250s1c1
Sequence:CCGGCCAGACCGTTATGTTGTAGTACTCGAGTACTACAACATAACGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011638.3-1870s1c1
Sequence:CCGGCGTTGAATTGAACCTGGACTACTCGAGTAGTCCAGGTTCAATTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011638.3-2137s21c1
Sequence:CCGGAGAGTCTCCTTTCCGACATATCTCGAGATATGTCGGAAAGGAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375694    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011638.3-2440s21c1
Sequence:CCGGATTCTACCCAATCATCTAATGCTCGAGCATTAGATGATTGGGTAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011638.3-539s21c1
Sequence:CCGGGATGAAAGTCTTGCCTATTATCTCGAGATAATAGGCAAGACTTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011638.3-2532s21c1
Sequence:CCGGGTGATATCTTCTCAGATTATCCTCGAGGATAATCTGAGAAGATATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011638.3-404s21c1
Sequence:CCGGCCTACATCATCTCGCTTATATCTCGAGATATAAGCGAGATGATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011638
VALIDATED
TFRC MISSION shRNA shRNA Plasmid DNA
transferrin receptor (p90, CD71)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011638.3-2087s1c1
Sequence:CCGGCGTATTATGAAAGTGGAGTATCTCGAGATACTCCACTTTCATAATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011638.3-192s1c1
Sequence:CCGGCCGACAATAACATGAAGGCTACTCGAGTAGCCTTCATGTTATTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011638.3-1250s1c1
Sequence:CCGGCCAGACCGTTATGTTGTAGTACTCGAGTACTACAACATAACGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011638.3-1870s1c1
Sequence:CCGGCGTTGAATTGAACCTGGACTACTCGAGTAGTCCAGGTTCAATTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011638.3-2137s21c1
Sequence:CCGGAGAGTCTCCTTTCCGACATATCTCGAGATATGTCGGAAAGGAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375694    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011638.3-2440s21c1
Sequence:CCGGATTCTACCCAATCATCTAATGCTCGAGCATTAGATGATTGGGTAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011638.3-539s21c1
Sequence:CCGGGATGAAAGTCTTGCCTATTATCTCGAGATAATAGGCAAGACTTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011638.3-2532s21c1
Sequence:CCGGGTGATATCTTCTCAGATTATCCTCGAGGATAATCTGAGAAGATATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011638.3-404s21c1
Sequence:CCGGCCTACATCATCTCGCTTATATCTCGAGATATAAGCGAGATGATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011638
VALIDATED
TFRC MISSION shRNA Lentiviral Transduction Particles
transferrin receptor (p90, CD71)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011638.3-2087s1c1
Sequence:CCGGCGTATTATGAAAGTGGAGTATCTCGAGATACTCCACTTTCATAATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011638.3-192s1c1
Sequence:CCGGCCGACAATAACATGAAGGCTACTCGAGTAGCCTTCATGTTATTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011638.3-1250s1c1
Sequence:CCGGCCAGACCGTTATGTTGTAGTACTCGAGTACTACAACATAACGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011638.3-1870s1c1
Sequence:CCGGCGTTGAATTGAACCTGGACTACTCGAGTAGTCCAGGTTCAATTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011638.3-2137s21c1
Sequence:CCGGAGAGTCTCCTTTCCGACATATCTCGAGATATGTCGGAAAGGAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375694    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011638.3-2440s21c1
Sequence:CCGGATTCTACCCAATCATCTAATGCTCGAGCATTAGATGATTGGGTAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011638.3-539s21c1
Sequence:CCGGGATGAAAGTCTTGCCTATTATCTCGAGATAATAGGCAAGACTTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011638.3-2532s21c1
Sequence:CCGGGTGATATCTTCTCAGATTATCCTCGAGGATAATCTGAGAAGATATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011638.3-404s21c1
Sequence:CCGGCCTACATCATCTCGCTTATATCTCGAGATATAAGCGAGATGATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003234
TFRC MISSION shRNA Bacterial Glycerol Stock
transferrin receptor (p90, CD71)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003234.1-1913s1c1
Sequence:CCGGCCCAGCAGTTTCTTTCTGTTTCTCGAGAAACAGAAAGAAACTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003234.1-2390s1c1
Sequence:CCGGGCCAGCTTTACTGGAGAACTTCTCGAGAAGTTCTCCAGTAAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003234.1-3564s1c1
Sequence:CCGGCCCAACAGATACTGGAAGTTTCTCGAGAAACTTCCAGTATCTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003234.1-783s1c1
Sequence:CCGGCGTGAATTTAAACTCAGCAAACTCGAGTTTGCTGAGTTTAAATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003234.1-2043s1c1
Sequence:CCGGGCTGGTCAGTTCGTGATTAAACTCGAGTTTAATCACGAACTGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003234.2-2063s21c1
Sequence:CCGGGCTGGTCAGTTCGTGATTAAACTCGAGTTTAATCACGAACTGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003234.2-803s21c1
Sequence:CCGGCGTGAATTTAAACTCAGCAAACTCGAGTTTGCTGAGTTTAAATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300334    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003234.2-3584s21c1
Sequence:CCGGCCCAACAGATACTGGAAGTTTCTCGAGAAACTTCCAGTATCTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003234.2-1933s21c1
Sequence:CCGGCCCAGCAGTTTCTTTCTGTTTCTCGAGAAACAGAAAGAAACTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003234.2-2410s21c1
Sequence:CCGGGCCAGCTTTACTGGAGAACTTCTCGAGAAGTTCTCCAGTAAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003234
TFRC MISSION shRNA shRNA Plasmid DNA
transferrin receptor (p90, CD71)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003234.1-1913s1c1
Sequence:CCGGCCCAGCAGTTTCTTTCTGTTTCTCGAGAAACAGAAAGAAACTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003234.1-2390s1c1
Sequence:CCGGGCCAGCTTTACTGGAGAACTTCTCGAGAAGTTCTCCAGTAAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003234.1-3564s1c1
Sequence:CCGGCCCAACAGATACTGGAAGTTTCTCGAGAAACTTCCAGTATCTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003234.1-783s1c1
Sequence:CCGGCGTGAATTTAAACTCAGCAAACTCGAGTTTGCTGAGTTTAAATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003234.1-2043s1c1
Sequence:CCGGGCTGGTCAGTTCGTGATTAAACTCGAGTTTAATCACGAACTGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003234.2-2063s21c1
Sequence:CCGGGCTGGTCAGTTCGTGATTAAACTCGAGTTTAATCACGAACTGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003234.2-803s21c1
Sequence:CCGGCGTGAATTTAAACTCAGCAAACTCGAGTTTGCTGAGTTTAAATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300334    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003234.2-3584s21c1
Sequence:CCGGCCCAACAGATACTGGAAGTTTCTCGAGAAACTTCCAGTATCTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003234.2-1933s21c1
Sequence:CCGGCCCAGCAGTTTCTTTCTGTTTCTCGAGAAACAGAAAGAAACTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003234.2-2410s21c1
Sequence:CCGGGCCAGCTTTACTGGAGAACTTCTCGAGAAGTTCTCCAGTAAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003234
TFRC MISSION shRNA Lentiviral Transduction Particles
transferrin receptor (p90, CD71)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003234.1-1913s1c1
Sequence:CCGGCCCAGCAGTTTCTTTCTGTTTCTCGAGAAACAGAAAGAAACTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003234.1-2390s1c1
Sequence:CCGGGCCAGCTTTACTGGAGAACTTCTCGAGAAGTTCTCCAGTAAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003234.1-3564s1c1
Sequence:CCGGCCCAACAGATACTGGAAGTTTCTCGAGAAACTTCCAGTATCTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003234.1-783s1c1
Sequence:CCGGCGTGAATTTAAACTCAGCAAACTCGAGTTTGCTGAGTTTAAATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003234.1-2043s1c1
Sequence:CCGGGCTGGTCAGTTCGTGATTAAACTCGAGTTTAATCACGAACTGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003234.2-2063s21c1
Sequence:CCGGGCTGGTCAGTTCGTGATTAAACTCGAGTTTAATCACGAACTGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003234.2-803s21c1
Sequence:CCGGCGTGAATTTAAACTCAGCAAACTCGAGTTTGCTGAGTTTAAATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300334    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003234.2-3584s21c1
Sequence:CCGGCCCAACAGATACTGGAAGTTTCTCGAGAAACTTCCAGTATCTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003234.2-1933s21c1
Sequence:CCGGCCCAGCAGTTTCTTTCTGTTTCTCGAGAAACAGAAAGAAACTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003234.2-2410s21c1
Sequence:CCGGGCCAGCTTTACTGGAGAACTTCTCGAGAAGTTCTCCAGTAAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks