EMAIL THIS PAGE TO A FRIEND

TG

thyroglobulin

Synonyms: AITD3 TGN
Gene ID:
Human(7038) Summary: Thyroglobulin (Tg) is a glycoprotein homodimer produced predominantly by the thryroid gland. It acts as a substrate for the synthesis of thyroxine and triiodothyronine as well as the storage of the inactive forms of thyroid hormone and iodine. Thyroglobulin is secreted from the endoplasmic reticulum to its site of iodination, and subsequent thyroxine biosynthesis, in the follicular lumen. Mutations in this gene cause thyroid dyshormonogenesis, manifested as goiter, and are associated with moderate to severe congenital hypothyroidism. Polymorphisms in this gene are associated with susceptibility to autoimmune thyroid diseases (AITD) such as Graves disease and Hashimoto thryoiditis. [provided by RefSeq, Nov 2009]
Mouse(21819) thyroglobulin
Rat(24826) thyroglobulin
fruit fly(252815) telegraph
Zebrafish(567631) thyroglobulin
chicken(100309546) Triglyceride level
fruit fly(34093) Transglutaminase
chicken(100529295) Triglyceride level
chicken(100529678) Triglyceride level
chicken(100857838) thyroglobulin
chicken(101410313) Triglyceride level
domestic cat(101088550) thyroglobulin
dog(482047) thyroglobulin
chicken(101410317) Triglyceride level
chicken(100529676) Triglyceride level
chicken(100529298) Triglyceride level
cow(280706) thyroglobulin
sheep(101122868) thyroglobulin
Goat(100750237) thyroglobulin
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009375 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009375 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009375 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003235 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003235 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003235 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU144931 MISSION® esiRNA esiRNA human TG (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003235 Rosetta Predictions human pricing
NM_030988 Rosetta Predictions rat pricing
NM_009375 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003235 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204738 predicted 3032
2 SASI_Hs01_00204739 predicted 1655
3 SASI_Hs01_00204740 predicted 8050
4 SASI_Hs01_00204741 predicted 1908
5 SASI_Hs01_00204742 predicted 1827
6 SASI_Hs02_00335269 predicted 660
7 SASI_Hs01_00204743 predicted 7982
8 SASI_Hs01_00204744 predicted 5709
9 SASI_Hs01_00204745 predicted 8035
10 SASI_Hs02_00335270 predicted 2821
11 SASI_Hs01_00204746 predicted 7627
12 SASI_Hs01_00204747 predicted 1356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030988 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057494 predicted 883
2 SASI_Rn01_00057495 predicted 5341
3 SASI_Rn01_00057496 predicted 2091
4 SASI_Rn01_00057497 predicted 6880
5 SASI_Rn01_00057498 predicted 860
6 SASI_Rn01_00057499 predicted 4741
7 SASI_Rn01_00057500 predicted 3113
8 SASI_Rn02_00264151 predicted 5581
9 SASI_Rn01_00057502 predicted 792
10 SASI_Rn01_00057503 predicted 1310
11 SASI_Rn01_00057501 predicted 450
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009375 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198839 predicted 1887
2 SASI_Mm01_00198840 predicted 4765
3 SASI_Mm01_00198841 predicted 4824
4 SASI_Mm01_00198843 predicted 4100
5 SASI_Mm02_00315982 predicted 947
6 SASI_Mm01_00198844 predicted 3095
7 SASI_Mm01_00198845 predicted 4920
8 SASI_Mm02_00315983 predicted 6678
9 SASI_Mm01_00198846 predicted 916
10 SASI_Mm02_00315984 predicted 7216
11 SASI_Mm01_00198838 predicted 7347
12 SASI_Mm01_00198842 predicted 1407
13 SASI_Mm01_00198847 predicted 407
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009375
TG MISSION shRNA Bacterial Glycerol Stock
thyroglobulin
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009375.2-3264s21c1
Sequence:CCGGCCAGAGCAAGTGGGTTGATTTCTCGAGAAATCAACCCACTTGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000454184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009375.2-1453s21c1
Sequence:CCGGGGCGAATGCTGCCCAGTTTAACTCGAGTTAAACTGGGCAGCATTCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009375.1-1763s1c1
Sequence:CCGGCGGAAGATATAGCGAGAGATTCTCGAGAATCTCTCGCTATATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009375.1-1228s1c1
Sequence:CCGGCCCAGAATCAAGGAACTCTTTCTCGAGAAAGAGTTCCTTGATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009375.1-1762s1c1
Sequence:CCGGCCGGAAGATATAGCGAGAGATCTCGAGATCTCTCGCTATATCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009375.1-7369s1c1
Sequence:CCGGCCTGCCAACATTCTCAATGATCTCGAGATCATTGAGAATGTTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009375.1-6307s1c1
Sequence:CCGGCCATCCATCAAGCACTTTGATCTCGAGATCAAAGTGCTTGATGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009375
TG MISSION shRNA shRNA Plasmid DNA
thyroglobulin
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009375.2-3264s21c1
Sequence:CCGGCCAGAGCAAGTGGGTTGATTTCTCGAGAAATCAACCCACTTGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000454184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009375.2-1453s21c1
Sequence:CCGGGGCGAATGCTGCCCAGTTTAACTCGAGTTAAACTGGGCAGCATTCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009375.1-1763s1c1
Sequence:CCGGCGGAAGATATAGCGAGAGATTCTCGAGAATCTCTCGCTATATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009375.1-1228s1c1
Sequence:CCGGCCCAGAATCAAGGAACTCTTTCTCGAGAAAGAGTTCCTTGATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009375.1-1762s1c1
Sequence:CCGGCCGGAAGATATAGCGAGAGATCTCGAGATCTCTCGCTATATCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009375.1-7369s1c1
Sequence:CCGGCCTGCCAACATTCTCAATGATCTCGAGATCATTGAGAATGTTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009375.1-6307s1c1
Sequence:CCGGCCATCCATCAAGCACTTTGATCTCGAGATCAAAGTGCTTGATGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009375
TG MISSION shRNA Lentiviral Transduction Particles
thyroglobulin
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009375.2-3264s21c1
Sequence:CCGGCCAGAGCAAGTGGGTTGATTTCTCGAGAAATCAACCCACTTGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000454184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009375.2-1453s21c1
Sequence:CCGGGGCGAATGCTGCCCAGTTTAACTCGAGTTAAACTGGGCAGCATTCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009375.1-1763s1c1
Sequence:CCGGCGGAAGATATAGCGAGAGATTCTCGAGAATCTCTCGCTATATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009375.1-1228s1c1
Sequence:CCGGCCCAGAATCAAGGAACTCTTTCTCGAGAAAGAGTTCCTTGATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009375.1-1762s1c1
Sequence:CCGGCCGGAAGATATAGCGAGAGATCTCGAGATCTCTCGCTATATCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009375.1-7369s1c1
Sequence:CCGGCCTGCCAACATTCTCAATGATCTCGAGATCATTGAGAATGTTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009375.1-6307s1c1
Sequence:CCGGCCATCCATCAAGCACTTTGATCTCGAGATCAAAGTGCTTGATGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003235
TG MISSION shRNA Bacterial Glycerol Stock
thyroglobulin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003235.4-5394s21c1
Sequence:CCGGGAGAGCCACCAGGTGATATTGCTCGAGCAATATCACCTGGTGGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003235.4-1653s21c1
Sequence:CCGGGCTAAGAAGGATGGTACTATGCTCGAGCATAGTACCATCCTTCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003235.4-6632s21c1
Sequence:CCGGTGTACCTTCTGTGCCCATTTCCTCGAGGAAATGGGCACAGAAGGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003235.3-2482s1c2
Sequence:CCGGCCGGAAACTTCAGTCTCTTTACTCGAGTAAAGAGACTGAAGTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003235.3-6055s1c1
Sequence:CCGGGCACTGGCTTTGGATTTCTAACTCGAGTTAGAAATCCAAAGCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003235.3-8049s1c1
Sequence:CCGGCCTTATGAGTTCTCACGGAAACTCGAGTTTCCGTGAGAACTCATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003235.3-3358s1c1
Sequence:CCGGCCTGCCTAGAAACAGGAGAATCTCGAGATTCTCCTGTTTCTAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003235.3-1602s1c1
Sequence:CCGGCCACTCTCTGTGGGATTAGATCTCGAGATCTAATCCCACAGAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003235
TG MISSION shRNA shRNA Plasmid DNA
thyroglobulin
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003235.4-5394s21c1
Sequence:CCGGGAGAGCCACCAGGTGATATTGCTCGAGCAATATCACCTGGTGGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003235.4-1653s21c1
Sequence:CCGGGCTAAGAAGGATGGTACTATGCTCGAGCATAGTACCATCCTTCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003235.4-6632s21c1
Sequence:CCGGTGTACCTTCTGTGCCCATTTCCTCGAGGAAATGGGCACAGAAGGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003235.3-2482s1c2
Sequence:CCGGCCGGAAACTTCAGTCTCTTTACTCGAGTAAAGAGACTGAAGTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003235.3-6055s1c1
Sequence:CCGGGCACTGGCTTTGGATTTCTAACTCGAGTTAGAAATCCAAAGCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003235.3-8049s1c1
Sequence:CCGGCCTTATGAGTTCTCACGGAAACTCGAGTTTCCGTGAGAACTCATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003235.3-3358s1c1
Sequence:CCGGCCTGCCTAGAAACAGGAGAATCTCGAGATTCTCCTGTTTCTAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003235.3-1602s1c1
Sequence:CCGGCCACTCTCTGTGGGATTAGATCTCGAGATCTAATCCCACAGAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003235
TG MISSION shRNA Lentiviral Transduction Particles
thyroglobulin
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003235.4-5394s21c1
Sequence:CCGGGAGAGCCACCAGGTGATATTGCTCGAGCAATATCACCTGGTGGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003235.4-1653s21c1
Sequence:CCGGGCTAAGAAGGATGGTACTATGCTCGAGCATAGTACCATCCTTCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003235.4-6632s21c1
Sequence:CCGGTGTACCTTCTGTGCCCATTTCCTCGAGGAAATGGGCACAGAAGGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003235.3-2482s1c2
Sequence:CCGGCCGGAAACTTCAGTCTCTTTACTCGAGTAAAGAGACTGAAGTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003235.3-6055s1c1
Sequence:CCGGGCACTGGCTTTGGATTTCTAACTCGAGTTAGAAATCCAAAGCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003235.3-8049s1c1
Sequence:CCGGCCTTATGAGTTCTCACGGAAACTCGAGTTTCCGTGAGAACTCATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003235.3-3358s1c1
Sequence:CCGGCCTGCCTAGAAACAGGAGAATCTCGAGATTCTCCTGTTTCTAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003235.3-1602s1c1
Sequence:CCGGCCACTCTCTGTGGGATTAGATCTCGAGATCTAATCCCACAGAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks