EMAIL THIS PAGE TO A FRIEND

TGDS

TDP-glucose 4,6-dehydratase

Synonyms: SDR2E1 TDPGD
UniProtKB ID: O95455, Q5T3Z2, Q9H1T9
Gene ID:
Mouse(76355) TDP-glucose 4,6-dehydratase
Rat(306164) TDP-glucose 4,6-dehydratase
Zebrafish(327507) TDP-glucose 4,6-dehydratase
domestic cat(101095221) TDP-glucose 4,6-dehydratase
dog(485521) TDP-glucose 4,6-dehydratase
chicken(418793) TDP-glucose 4,6-dehydratase
cow(534594) TDP-glucose 4,6-dehydratase
sheep(101107366) TDP-glucose 4,6-dehydratase
domestic guinea pig(100718530) TDP-glucose 4,6-dehydratase
naked mole-rat(101703030) TDP-glucose 4,6-dehydratase
Gene Class: Dehydratase
91 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014305 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014305 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014305 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029578 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029578 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029578 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014305 Rosetta Predictions human pricing
NM_001107286 Rosetta Predictions rat pricing
NM_029578 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014305 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345392 predicted 305
2 SASI_Hs01_00114329 predicted 1098
3 SASI_Hs01_00114330 predicted 1159
4 SASI_Hs02_00345393 predicted 452
5 SASI_Hs01_00114331 predicted 352
6 SASI_Hs01_00114332 predicted 993
7 SASI_Hs01_00114333 predicted 1249
8 SASI_Hs01_00114334 predicted 654
9 SASI_Hs01_00114335 predicted 1047
10 SASI_Hs01_00114336 predicted 422
11 SASI_Hs01_00114337 predicted 342
12 SASI_Hs01_00114338 predicted 1155
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107286 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227345 predicted 739
2 SASI_Rn02_00227346 predicted 1224
3 SASI_Rn02_00227347 predicted 819
4 SASI_Rn02_00227348 predicted 1090
5 SASI_Rn02_00227349 predicted 383
6 SASI_Rn02_00227350 predicted 642
7 SASI_Rn02_00227351 predicted 654
8 SASI_Rn02_00227352 predicted 1037
9 SASI_Rn02_00227353 predicted 1080
10 SASI_Rn02_00227354 predicted 1000
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029578 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194915 predicted 839
2 SASI_Mm01_00194916 predicted 359
3 SASI_Mm01_00194917 predicted 591
4 SASI_Mm01_00194919 predicted 397
5 SASI_Mm01_00194920 predicted 913
6 SASI_Mm02_00335526 predicted 235
7 SASI_Mm01_00194921 predicted 597
8 SASI_Mm01_00194923 predicted 559
9 SASI_Mm01_00194924 predicted 224
10 SASI_Mm02_00335527 predicted 241
11 SASI_Mm01_00194918 predicted 1126
12 SASI_Mm01_00194922 predicted 1038
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014305
VALIDATED
TGDS MISSION shRNA Bacterial Glycerol Stock
TDP-glucose 4,6-dehydratase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014305.1-425s1c1
Sequence:CCGGCCTTTGAGTTTACCTATGTTACTCGAGTAACATAGGTAAACTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014305.1-895s1c1
Sequence:CCGGCTTGCCAAAGAACTAATACAACTCGAGTTGTATTAGTTCTTTGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014305.1-259s1c1
Sequence:CCGGGCAAGCTTGAAGAATCTTGAACTCGAGTTCAAGATTCTTCAAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014305.1-169s1c1
Sequence:CCGGGCTGGTTTCATTGCATCACATCTCGAGATGTGATGCAATGAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014305.1-487s1c1
Sequence:CCGGGCCAGAGTGGAGAAGTTTATTCTCGAGAATAAACTTCTCCACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014305.2-197s21c1
Sequence:CCGGGCTGGTTTCATTGCATCACATCTCGAGATGTGATGCAATGAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293878    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014305.2-1564s21c1
Sequence:CCGGTAGGATGTCTTAGGCCCTAATCTCGAGATTAGGGCCTAAGACATCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014305.2-287s21c1
Sequence:CCGGGCAAGCTTGAAGAATCTTGAACTCGAGTTCAAGATTCTTCAAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014305.2-923s21c1
Sequence:CCGGCTTGCCAAAGAACTAATACAACTCGAGTTGTATTAGTTCTTTGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014305.2-515s21c1
Sequence:CCGGGCCAGAGTGGAGAAGTTTATTCTCGAGAATAAACTTCTCCACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014305
VALIDATED
TGDS MISSION shRNA shRNA Plasmid DNA
TDP-glucose 4,6-dehydratase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014305.1-425s1c1
Sequence:CCGGCCTTTGAGTTTACCTATGTTACTCGAGTAACATAGGTAAACTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014305.1-895s1c1
Sequence:CCGGCTTGCCAAAGAACTAATACAACTCGAGTTGTATTAGTTCTTTGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014305.1-259s1c1
Sequence:CCGGGCAAGCTTGAAGAATCTTGAACTCGAGTTCAAGATTCTTCAAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014305.1-169s1c1
Sequence:CCGGGCTGGTTTCATTGCATCACATCTCGAGATGTGATGCAATGAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014305.1-487s1c1
Sequence:CCGGGCCAGAGTGGAGAAGTTTATTCTCGAGAATAAACTTCTCCACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014305.2-197s21c1
Sequence:CCGGGCTGGTTTCATTGCATCACATCTCGAGATGTGATGCAATGAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293878    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014305.2-1564s21c1
Sequence:CCGGTAGGATGTCTTAGGCCCTAATCTCGAGATTAGGGCCTAAGACATCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014305.2-287s21c1
Sequence:CCGGGCAAGCTTGAAGAATCTTGAACTCGAGTTCAAGATTCTTCAAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014305.2-923s21c1
Sequence:CCGGCTTGCCAAAGAACTAATACAACTCGAGTTGTATTAGTTCTTTGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014305.2-515s21c1
Sequence:CCGGGCCAGAGTGGAGAAGTTTATTCTCGAGAATAAACTTCTCCACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014305
VALIDATED
TGDS MISSION shRNA Lentiviral Transduction Particles
TDP-glucose 4,6-dehydratase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014305.1-425s1c1
Sequence:CCGGCCTTTGAGTTTACCTATGTTACTCGAGTAACATAGGTAAACTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014305.1-895s1c1
Sequence:CCGGCTTGCCAAAGAACTAATACAACTCGAGTTGTATTAGTTCTTTGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014305.1-259s1c1
Sequence:CCGGGCAAGCTTGAAGAATCTTGAACTCGAGTTCAAGATTCTTCAAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014305.1-169s1c1
Sequence:CCGGGCTGGTTTCATTGCATCACATCTCGAGATGTGATGCAATGAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014305.1-487s1c1
Sequence:CCGGGCCAGAGTGGAGAAGTTTATTCTCGAGAATAAACTTCTCCACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014305.2-197s21c1
Sequence:CCGGGCTGGTTTCATTGCATCACATCTCGAGATGTGATGCAATGAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293878    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014305.2-1564s21c1
Sequence:CCGGTAGGATGTCTTAGGCCCTAATCTCGAGATTAGGGCCTAAGACATCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014305.2-287s21c1
Sequence:CCGGGCAAGCTTGAAGAATCTTGAACTCGAGTTCAAGATTCTTCAAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014305.2-923s21c1
Sequence:CCGGCTTGCCAAAGAACTAATACAACTCGAGTTGTATTAGTTCTTTGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014305.2-515s21c1
Sequence:CCGGGCCAGAGTGGAGAAGTTTATTCTCGAGAATAAACTTCTCCACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029578
TGDS MISSION shRNA Bacterial Glycerol Stock
TDP-glucose 4,6-dehydratase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114546    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029578.2-1121s1c1
Sequence:CCGGGCAATGTGAATCAAGTGCCTACTCGAGTAGGCACTTGATTCACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029578.2-136s1c1
Sequence:CCGGCCCGACTATATGATCGTAAATCTCGAGATTTACGATCATATAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029578.2-543s1c1
Sequence:CCGGGCAGTCTTACTGGGAAAGGTACTCGAGTACCTTTCCCAGTAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029578.2-360s1c1
Sequence:CCGGCGTCAATGTTTATGGTACTCACTCGAGTGAGTACCATAAACATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029578.2-898s1c1
Sequence:CCGGCCTCACAATGACATGAGATATCTCGAGATATCTCATGTCATTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029578
TGDS MISSION shRNA shRNA Plasmid DNA
TDP-glucose 4,6-dehydratase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114546    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029578.2-1121s1c1
Sequence:CCGGGCAATGTGAATCAAGTGCCTACTCGAGTAGGCACTTGATTCACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029578.2-136s1c1
Sequence:CCGGCCCGACTATATGATCGTAAATCTCGAGATTTACGATCATATAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029578.2-543s1c1
Sequence:CCGGGCAGTCTTACTGGGAAAGGTACTCGAGTACCTTTCCCAGTAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029578.2-360s1c1
Sequence:CCGGCGTCAATGTTTATGGTACTCACTCGAGTGAGTACCATAAACATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029578.2-898s1c1
Sequence:CCGGCCTCACAATGACATGAGATATCTCGAGATATCTCATGTCATTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029578
TGDS MISSION shRNA Lentiviral Transduction Particles
TDP-glucose 4,6-dehydratase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114546    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029578.2-1121s1c1
Sequence:CCGGGCAATGTGAATCAAGTGCCTACTCGAGTAGGCACTTGATTCACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029578.2-136s1c1
Sequence:CCGGCCCGACTATATGATCGTAAATCTCGAGATTTACGATCATATAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029578.2-543s1c1
Sequence:CCGGGCAGTCTTACTGGGAAAGGTACTCGAGTACCTTTCCCAGTAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029578.2-360s1c1
Sequence:CCGGCGTCAATGTTTATGGTACTCACTCGAGTGAGTACCATAAACATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029578.2-898s1c1
Sequence:CCGGCCTCACAATGACATGAGATATCTCGAGATATCTCATGTCATTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks