EMAIL THIS PAGE TO A FRIEND

TGFA

transforming growth factor, alpha

Synonyms: TFGA
Gene ID:
Human(7039) Summary: This gene encodes a growth factor that is a ligand for the epidermal growth factor receptor, which activates a signaling pathway for cell proliferation, differentiation and development. This protein may act as either a transmembrane-bound ligand or a soluble ligand. This gene has been associated with many types of cancers, and it may also be involved in some cases of cleft lip/palate. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Mouse(21802) transforming growth factor alpha
Rat(24827) transforming growth factor alpha
cow(540388) transforming growth factor, alpha
sheep(101106508) transforming growth factor, alpha
Zebrafish(100034402) transforming growth factor, alpha
domestic cat(101094921) transforming growth factor, alpha
dog(403431) transforming growth factor, alpha
chicken(414743) transforming growth factor, alpha
124 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003236 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003236 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003236 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031199 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031199 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031199 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU059871 MISSION® esiRNA esiRNA targeting mouse Tgfa (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099691 Rosetta Predictions human pricing
NM_003236 Rosetta Predictions human pricing
NM_012671 Rosetta Predictions rat pricing
NM_031199 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099691 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321115 predicted 783
2 SASI_Hs02_00321116 predicted 967
3 SASI_Hs02_00321117 predicted 1082
4 SASI_Hs02_00321118 predicted 1185
5 SASI_Hs02_00321119 predicted 785
6 SASI_Hs02_00321120 predicted 1074
7 SASI_Hs02_00321121 predicted 709
8 SASI_Hs02_00321122 predicted 1158
9 SASI_Hs02_00321123 predicted 706
10 SASI_Hs02_00321124 predicted 935
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003236 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220316 predicted 781
2 SASI_Hs01_00220317 predicted 976
3 SASI_Hs01_00220318 predicted 1082
4 SASI_Hs01_00220319 predicted 1183
5 SASI_Hs01_00220321 predicted 784
6 SASI_Hs01_00220322 predicted 1073
7 SASI_Hs01_00220323 predicted 715
8 SASI_Hs01_00220324 predicted 1164
9 SASI_Hs01_00220325 predicted 709
10 SASI_Hs02_00335271 predicted 938
11 SASI_Hs01_00220320 predicted 914
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012671 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070113 predicted 1031
2 SASI_Rn02_00259942 predicted 283
3 SASI_Rn01_00070114 predicted 649
4 SASI_Rn01_00070115 predicted 614
5 SASI_Rn01_00070116 predicted 838
6 SASI_Rn01_00070117 predicted 763
7 SASI_Rn01_00070118 predicted 827
8 SASI_Rn01_00070119 predicted 1047
9 SASI_Rn01_00070120 predicted 836
10 SASI_Rn01_00070122 predicted 363
11 SASI_Rn01_00070121 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031199 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174068 predicted 890
2 SASI_Mm01_00174069 predicted 981
3 SASI_Mm02_00337062 predicted 596
4 SASI_Mm01_00174070 predicted 1045
5 SASI_Mm01_00174071 predicted 447
6 SASI_Mm01_00174072 predicted 1053
7 SASI_Mm01_00174073 predicted 895
8 SASI_Mm01_00174074 predicted 448
9 SASI_Mm01_00174075 predicted 660
10 SASI_Mm01_00174076 predicted 1034
11 SASI_Mm01_00174077 predicted 1053
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003236
VALIDATED
TGFA MISSION shRNA Bacterial Glycerol Stock
transforming growth factor, alpha
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003236.2-421s21c1
Sequence:CCGGTCTGCCATTCTGGGTACGTTGCTCGAGCAACGTACCCAGAATGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003236.2-550s21c1
Sequence:CCGGTCATCACATGTGTGCTGATACCTCGAGGTATCAGCACACATGTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003236.2-317s21c1
Sequence:CCGGTGCAGCAGTGGTGTCCCATTTCTCGAGAAATGGGACACCACTGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003236.2-233s21c1
Sequence:CCGGCCTGTTCGCTCTGGGTATTGTCTCGAGACAATACCCAGAGCGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003236.2-348s21c1
Sequence:CCGGCCAGATTCCCACACTCAGTTCCTCGAGGAACTGAGTGTGGGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003236.2-646s21c1
Sequence:CCGGTGAAGGGAAGAACCGCTTGCTCTCGAGAGCAAGCGGTTCTTCCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003236.2-488s21c1
Sequence:CCGGCCAGAAGAAGCAGGCCATCACCTCGAGGTGATGGCCTGCTTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006373    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003236.1-729s1c1
Sequence:CCGGCCACGATTTCAAGACTTGTTACTCGAGTAACAAGTCTTGAAATCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_003236.1-370s1c1
Sequence:CCGGCCTTATCATCACATGTGTGCTCTCGAGAGCACACATGTGATGATAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003236.1-363s1c1
Sequence:CCGGTGGCTGTCCTTATCATCACATCTCGAGATGTGATGATAAGGACAGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003236.1-61s1c1
Sequence:CCGGGTTCGCTCTGGGTATTGTGTTCTCGAGAACACAATACCCAGAGCGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003236.1-196s1c1
Sequence:CCGGCTTCCATGGAACCTGCAGGTTCTCGAGAACCTGCAGGTTCCATGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003236
VALIDATED
TGFA MISSION shRNA shRNA Plasmid DNA
transforming growth factor, alpha
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003236.2-421s21c1
Sequence:CCGGTCTGCCATTCTGGGTACGTTGCTCGAGCAACGTACCCAGAATGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003236.2-550s21c1
Sequence:CCGGTCATCACATGTGTGCTGATACCTCGAGGTATCAGCACACATGTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003236.2-317s21c1
Sequence:CCGGTGCAGCAGTGGTGTCCCATTTCTCGAGAAATGGGACACCACTGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003236.2-233s21c1
Sequence:CCGGCCTGTTCGCTCTGGGTATTGTCTCGAGACAATACCCAGAGCGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003236.2-348s21c1
Sequence:CCGGCCAGATTCCCACACTCAGTTCCTCGAGGAACTGAGTGTGGGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003236.2-646s21c1
Sequence:CCGGTGAAGGGAAGAACCGCTTGCTCTCGAGAGCAAGCGGTTCTTCCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003236.2-488s21c1
Sequence:CCGGCCAGAAGAAGCAGGCCATCACCTCGAGGTGATGGCCTGCTTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006373    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003236.1-729s1c1
Sequence:CCGGCCACGATTTCAAGACTTGTTACTCGAGTAACAAGTCTTGAAATCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_003236.1-370s1c1
Sequence:CCGGCCTTATCATCACATGTGTGCTCTCGAGAGCACACATGTGATGATAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003236.1-363s1c1
Sequence:CCGGTGGCTGTCCTTATCATCACATCTCGAGATGTGATGATAAGGACAGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003236.1-61s1c1
Sequence:CCGGGTTCGCTCTGGGTATTGTGTTCTCGAGAACACAATACCCAGAGCGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003236.1-196s1c1
Sequence:CCGGCTTCCATGGAACCTGCAGGTTCTCGAGAACCTGCAGGTTCCATGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003236
VALIDATED
TGFA MISSION shRNA Lentiviral Transduction Particles
transforming growth factor, alpha
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003236.2-421s21c1
Sequence:CCGGTCTGCCATTCTGGGTACGTTGCTCGAGCAACGTACCCAGAATGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003236.2-550s21c1
Sequence:CCGGTCATCACATGTGTGCTGATACCTCGAGGTATCAGCACACATGTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003236.2-317s21c1
Sequence:CCGGTGCAGCAGTGGTGTCCCATTTCTCGAGAAATGGGACACCACTGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003236.2-233s21c1
Sequence:CCGGCCTGTTCGCTCTGGGTATTGTCTCGAGACAATACCCAGAGCGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003236.2-348s21c1
Sequence:CCGGCCAGATTCCCACACTCAGTTCCTCGAGGAACTGAGTGTGGGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003236.2-646s21c1
Sequence:CCGGTGAAGGGAAGAACCGCTTGCTCTCGAGAGCAAGCGGTTCTTCCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003236.2-488s21c1
Sequence:CCGGCCAGAAGAAGCAGGCCATCACCTCGAGGTGATGGCCTGCTTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006373    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003236.1-729s1c1
Sequence:CCGGCCACGATTTCAAGACTTGTTACTCGAGTAACAAGTCTTGAAATCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_003236.1-370s1c1
Sequence:CCGGCCTTATCATCACATGTGTGCTCTCGAGAGCACACATGTGATGATAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003236.1-363s1c1
Sequence:CCGGTGGCTGTCCTTATCATCACATCTCGAGATGTGATGATAAGGACAGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003236.1-61s1c1
Sequence:CCGGGTTCGCTCTGGGTATTGTGTTCTCGAGAACACAATACCCAGAGCGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003236.1-196s1c1
Sequence:CCGGCTTCCATGGAACCTGCAGGTTCTCGAGAACCTGCAGGTTCCATGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031199
VALIDATED
TGFA MISSION shRNA Bacterial Glycerol Stock
transforming growth factor, alpha
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000312199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031199.2-450s21c1
Sequence:CCGGCCACTGCTGTCAGCTCCGCAACTCGAGTTGCGGAGCTGACAGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031199.2-216s21c1
Sequence:CCGGCTTCAACAAGTGCCCAGATTCCTCGAGGAATCTGGGCACTTGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031199.2-122s21c1
Sequence:CCGGTAGCGCTGGGTATCCTGTTAGCTCGAGCTAACAGGATACCCAGCGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031199.2-253s21c1
Sequence:CCGGTTCCATGGAACCTGCCGGTTTCTCGAGAAACCGGCAGGTTCCATGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313254    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031199.2-1042s21c1
Sequence:CCGGTCGTCAGGATGCGTGTCTTATCTCGAGATAAGACACGCATCCTGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031199.1-1600s1c1
Sequence:CCGGCCCTTTAATAATGTTGGCATTCTCGAGAATGCCAACATTATTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031199.1-215s1c1
Sequence:CCGGACTTCAACAAGTGCCCAGATTCTCGAGAATCTGGGCACTTGTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031199.1-450s1c1
Sequence:CCGGCCACTGCTGTCAGCTCCGCAACTCGAGTTGCGGAGCTGACAGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031199.1-307s1c1
Sequence:CCGGCACTCTGGGTACGTGGGTGTTCTCGAGAACACCCACGTACCCAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031199
VALIDATED
TGFA MISSION shRNA shRNA Plasmid DNA
transforming growth factor, alpha
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000312199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031199.2-450s21c1
Sequence:CCGGCCACTGCTGTCAGCTCCGCAACTCGAGTTGCGGAGCTGACAGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031199.2-216s21c1
Sequence:CCGGCTTCAACAAGTGCCCAGATTCCTCGAGGAATCTGGGCACTTGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031199.2-122s21c1
Sequence:CCGGTAGCGCTGGGTATCCTGTTAGCTCGAGCTAACAGGATACCCAGCGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031199.2-253s21c1
Sequence:CCGGTTCCATGGAACCTGCCGGTTTCTCGAGAAACCGGCAGGTTCCATGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313254    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031199.2-1042s21c1
Sequence:CCGGTCGTCAGGATGCGTGTCTTATCTCGAGATAAGACACGCATCCTGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031199.1-1600s1c1
Sequence:CCGGCCCTTTAATAATGTTGGCATTCTCGAGAATGCCAACATTATTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031199.1-215s1c1
Sequence:CCGGACTTCAACAAGTGCCCAGATTCTCGAGAATCTGGGCACTTGTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031199.1-450s1c1
Sequence:CCGGCCACTGCTGTCAGCTCCGCAACTCGAGTTGCGGAGCTGACAGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031199.1-307s1c1
Sequence:CCGGCACTCTGGGTACGTGGGTGTTCTCGAGAACACCCACGTACCCAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031199
VALIDATED
TGFA MISSION shRNA Lentiviral Transduction Particles
transforming growth factor, alpha
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000312199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031199.2-450s21c1
Sequence:CCGGCCACTGCTGTCAGCTCCGCAACTCGAGTTGCGGAGCTGACAGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031199.2-216s21c1
Sequence:CCGGCTTCAACAAGTGCCCAGATTCCTCGAGGAATCTGGGCACTTGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031199.2-122s21c1
Sequence:CCGGTAGCGCTGGGTATCCTGTTAGCTCGAGCTAACAGGATACCCAGCGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031199.2-253s21c1
Sequence:CCGGTTCCATGGAACCTGCCGGTTTCTCGAGAAACCGGCAGGTTCCATGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313254    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031199.2-1042s21c1
Sequence:CCGGTCGTCAGGATGCGTGTCTTATCTCGAGATAAGACACGCATCCTGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031199.1-1600s1c1
Sequence:CCGGCCCTTTAATAATGTTGGCATTCTCGAGAATGCCAACATTATTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031199.1-215s1c1
Sequence:CCGGACTTCAACAAGTGCCCAGATTCTCGAGAATCTGGGCACTTGTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031199.1-450s1c1
Sequence:CCGGCCACTGCTGTCAGCTCCGCAACTCGAGTTGCGGAGCTGACAGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031199.1-307s1c1
Sequence:CCGGCACTCTGGGTACGTGGGTGTTCTCGAGAACACCCACGTACCCAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks