EMAIL THIS PAGE TO A FRIEND

TGFB1

transforming growth factor, beta 1

Synonyms: CED DPD1 LAP TGFB TGFbeta
UniProtKB ID: P01137, A8K792, Q9UCG4
Gene ID:
Human(7040) Summary: This gene encodes a member of the transforming growth factor beta (TGFB) family of cytokines, which are multifunctional peptides that regulate proliferation, differentiation, adhesion, migration, and other functions in many cell types. Many cells have TGFB receptors, and the protein positively and negatively regulates many other growth factors. The secreted protein is cleaved into a latency-associated peptide (LAP) and a mature TGFB1 peptide, and is found in either a latent form composed of a TGFB1 homodimer, a LAP homodimer, and a latent TGFB1-binding protein, or in an active form composed of a TGFB1 homodimer. The mature peptide may also form heterodimers with other TGFB family members. This gene is frequently upregulated in tumor cells, and mutations in this gene result in Camurati-Engelmann disease.[provided by RefSeq, Oct 2009]
Mouse(21803) transforming growth factor, beta 1
Rat(59086) transforming growth factor, beta 1
chicken(100873157) transforming growth factor beta 1
Horse(100033900) transforming growth factor, beta 1
dog(403998) transforming growth factor, beta 1
domestic cat(768263) transforming growth factor, beta 1
domestic guinea pig(100135628) transforming growth factor, beta 1
naked mole-rat(101704230) transforming growth factor, beta 1
Domestic Rabbit(100008645) transforming growth factor, beta 1
cow(282089) transforming growth factor, beta 1
sheep(443417) transforming growth factor, beta 1
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4502954 Anti-TGF β1, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
SAB2108510 Anti-TGFB1 IgG fraction of antiserum guinea pig, pig, guinea pig, rabbit, goat, mouse, human, horse, canine, rat, sheep
western blot pricing
SAB2108514 Anti-TGFB1 affinity isolated antibody horse, rat, sheep, goat, pig, bovine, canine, mouse, guinea pig
immunohistochemistry, western blot pricing
AV37894 Anti-TGFB1 antibody produced in rabbit affinity isolated antibody horse, rat, mouse, pig, guinea pig, canine, bovine
western blot pricing
AV37156 Anti-TGFB1 antibody produced in rabbit IgG fraction of antiserum guinea pig, pig, mouse, rabbit, human, bovine, rat, sheep, canine, horse, goat
western blot pricing
T9429 Anti-Transforming Growth Factor-β, pan antibody produced in rabbit IgG fraction of antiserum, lyophilized powder human, amphibian, pig
microarray, neutralization, western blot pricing
T0688 Anti-Transforming Growth Factor-β1 antibody produced in chicken affinity isolated antibody, lyophilized powder human
neutralization, western blot pricing
SAB5300197 Monoclonal Anti-TGFB1 antibody produced in mouse clone 4F9C10, ascites fluid human
ELISA, western blot pricing
T0438 Monoclonal Anti-Transforming Growth Factor-β1 antibody produced in mouse clone 9016.2, purified immunoglobulin, lyophilized powder rat, mouse, human
ELISA, immunohistochemistry, neutralization, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011577 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011577 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011577 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000660 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000660 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000660 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000660 Rosetta Predictions human pricing
NM_021578 Rosetta Predictions rat pricing
NM_011577 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000660 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108651 predicted 1387
2 SASI_Hs01_00108652 predicted 1198
3 SASI_Hs01_00108654 predicted 1555
4 SASI_Hs01_00108655 predicted 1238
5 SASI_Hs01_00108656 predicted 1213
6 SASI_Hs01_00108657 predicted 1512
7 SASI_Hs01_00108658 predicted 1177
8 SASI_Hs01_00108659 predicted 1245
9 SASI_Hs01_00108660 predicted 1329
10 SASI_Hs02_00303024 predicted 1566
11 SASI_Hs01_00108653 predicted 1632
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021578 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116689 predicted 461
2 SASI_Rn01_00116690 predicted 528
3 SASI_Rn01_00116691 predicted 782
4 SASI_Rn01_00116692 predicted 659
5 SASI_Rn01_00116693 predicted 238
6 SASI_Rn02_00262604 predicted 1050
7 SASI_Rn01_00116694 predicted 468
8 SASI_Rn01_00116695 predicted 802
9 SASI_Rn01_00116696 predicted 903
10 SASI_Rn01_00116697 predicted 1025
11 SASI_Rn01_00116698 predicted 785
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011577 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114870 predicted 1208
2 SASI_Mm02_00320969 predicted 1525
3 SASI_Mm01_00114871 predicted 1241
4 SASI_Mm01_00114872 predicted 1235
5 SASI_Mm01_00114873 predicted 1383
6 SASI_Mm01_00114874 predicted 1249
7 SASI_Mm01_00114875 predicted 1501
8 SASI_Mm01_00114876 predicted 1366
9 SASI_Mm01_00114877 predicted 960
10 SASI_Mm01_00114878 predicted 1189
11 SASI_Mm01_00114879 predicted 1391
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011577
VALIDATED
TGFB1 MISSION shRNA Bacterial Glycerol Stock
transforming growth factor, beta 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011577.1-1753s1c1
Sequence:CCGGCGGCAGCTGTACATTGACTTTCTCGAGAAAGTCAATGTACAGCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011577.1-1704s1c1
Sequence:CCGGCCTGGATACCAACTATTGCTTCTCGAGAAGCAATAGTTGGTATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011577.1-1535s1c1
Sequence:CCGGGCTCTTGTGACAGCAAAGATACTCGAGTATCTTTGCTGTCACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011577.1-1329s1c1
Sequence:CCGGGCTGCGCTTGCAGAGATTAAACTCGAGTTTAATCTCTGCAAGCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011577.1-1164s1c1
Sequence:CCGGCGAAGCGGACTACTATGCTAACTCGAGTTAGCATAGTAGTCCGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011577.1-1753s21c1
Sequence:CCGGCGGCAGCTGTACATTGACTTTCTCGAGAAAGTCAATGTACAGCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011577.1-1329s21c1
Sequence:CCGGGCTGCGCTTGCAGAGATTAAACTCGAGTTTAATCTCTGCAAGCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011577.1-1164s21c1
Sequence:CCGGCGAAGCGGACTACTATGCTAACTCGAGTTAGCATAGTAGTCCGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011577.1-1535s21c1
Sequence:CCGGGCTCTTGTGACAGCAAAGATACTCGAGTATCTTTGCTGTCACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011577
VALIDATED
TGFB1 MISSION shRNA shRNA Plasmid DNA
transforming growth factor, beta 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011577.1-1753s1c1
Sequence:CCGGCGGCAGCTGTACATTGACTTTCTCGAGAAAGTCAATGTACAGCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011577.1-1704s1c1
Sequence:CCGGCCTGGATACCAACTATTGCTTCTCGAGAAGCAATAGTTGGTATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011577.1-1535s1c1
Sequence:CCGGGCTCTTGTGACAGCAAAGATACTCGAGTATCTTTGCTGTCACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011577.1-1329s1c1
Sequence:CCGGGCTGCGCTTGCAGAGATTAAACTCGAGTTTAATCTCTGCAAGCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011577.1-1164s1c1
Sequence:CCGGCGAAGCGGACTACTATGCTAACTCGAGTTAGCATAGTAGTCCGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011577.1-1753s21c1
Sequence:CCGGCGGCAGCTGTACATTGACTTTCTCGAGAAAGTCAATGTACAGCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011577.1-1329s21c1
Sequence:CCGGGCTGCGCTTGCAGAGATTAAACTCGAGTTTAATCTCTGCAAGCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011577.1-1164s21c1
Sequence:CCGGCGAAGCGGACTACTATGCTAACTCGAGTTAGCATAGTAGTCCGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011577.1-1535s21c1
Sequence:CCGGGCTCTTGTGACAGCAAAGATACTCGAGTATCTTTGCTGTCACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011577
VALIDATED
TGFB1 MISSION shRNA Lentiviral Transduction Particles
transforming growth factor, beta 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011577.1-1753s1c1
Sequence:CCGGCGGCAGCTGTACATTGACTTTCTCGAGAAAGTCAATGTACAGCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011577.1-1704s1c1
Sequence:CCGGCCTGGATACCAACTATTGCTTCTCGAGAAGCAATAGTTGGTATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011577.1-1535s1c1
Sequence:CCGGGCTCTTGTGACAGCAAAGATACTCGAGTATCTTTGCTGTCACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011577.1-1329s1c1
Sequence:CCGGGCTGCGCTTGCAGAGATTAAACTCGAGTTTAATCTCTGCAAGCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011577.1-1164s1c1
Sequence:CCGGCGAAGCGGACTACTATGCTAACTCGAGTTAGCATAGTAGTCCGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011577.1-1753s21c1
Sequence:CCGGCGGCAGCTGTACATTGACTTTCTCGAGAAAGTCAATGTACAGCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011577.1-1329s21c1
Sequence:CCGGGCTGCGCTTGCAGAGATTAAACTCGAGTTTAATCTCTGCAAGCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011577.1-1164s21c1
Sequence:CCGGCGAAGCGGACTACTATGCTAACTCGAGTTAGCATAGTAGTCCGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011577.1-1535s21c1
Sequence:CCGGGCTCTTGTGACAGCAAAGATACTCGAGTATCTTTGCTGTCACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000660
VALIDATED
TGFB1 MISSION shRNA Bacterial Glycerol Stock
transforming growth factor, beta 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003316    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000660.x-2154s1c1
Sequence:CCGGACTGCGGATCTCTGTGTCATTCTCGAGAATGACACAGAGATCCGCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000660.x-1167s1c1
Sequence:CCGGCCCGCGTGCTAATGGTGGAAACTCGAGTTTCCACCATTAGCACGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000660.x-1189s1c1
Sequence:CCGGCCACAACGAAATCTATGACAACTCGAGTTGTCATAGATTTCGTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000660.x-1213s1c1
Sequence:CCGGCAAGCAGAGTACACACAGCATCTCGAGATGCTGTGTGTACTCTGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000660.x-1606s1c1
Sequence:CCGGCCGGCCTTTCCTGCTTCTCATCTCGAGATGAGAAGCAGGAAAGGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000660.3-1629s21c1
Sequence:CCGGCCGGCCTTTCCTGCTTCTCATCTCGAGATGAGAAGCAGGAAAGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000660.3-1193s21c1
Sequence:CCGGCCCGCGTGCTAATGGTGGAAACTCGAGTTTCCACCATTAGCACGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000660.3-1239s21c1
Sequence:CCGGCAAGCAGAGTACACACAGCATCTCGAGATGCTGTGTGTACTCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000660.3-1215s21c1
Sequence:CCGGCCACAACGAAATCTATGACAACTCGAGTTGTCATAGATTTCGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000660
VALIDATED
TGFB1 MISSION shRNA shRNA Plasmid DNA
transforming growth factor, beta 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003316    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000660.x-2154s1c1
Sequence:CCGGACTGCGGATCTCTGTGTCATTCTCGAGAATGACACAGAGATCCGCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000660.x-1167s1c1
Sequence:CCGGCCCGCGTGCTAATGGTGGAAACTCGAGTTTCCACCATTAGCACGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000660.x-1189s1c1
Sequence:CCGGCCACAACGAAATCTATGACAACTCGAGTTGTCATAGATTTCGTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000660.x-1213s1c1
Sequence:CCGGCAAGCAGAGTACACACAGCATCTCGAGATGCTGTGTGTACTCTGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000660.x-1606s1c1
Sequence:CCGGCCGGCCTTTCCTGCTTCTCATCTCGAGATGAGAAGCAGGAAAGGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000660.3-1629s21c1
Sequence:CCGGCCGGCCTTTCCTGCTTCTCATCTCGAGATGAGAAGCAGGAAAGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000660.3-1193s21c1
Sequence:CCGGCCCGCGTGCTAATGGTGGAAACTCGAGTTTCCACCATTAGCACGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000660.3-1239s21c1
Sequence:CCGGCAAGCAGAGTACACACAGCATCTCGAGATGCTGTGTGTACTCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000660.3-1215s21c1
Sequence:CCGGCCACAACGAAATCTATGACAACTCGAGTTGTCATAGATTTCGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000660
VALIDATED
TGFB1 MISSION shRNA Lentiviral Transduction Particles
transforming growth factor, beta 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003316    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000660.x-2154s1c1
Sequence:CCGGACTGCGGATCTCTGTGTCATTCTCGAGAATGACACAGAGATCCGCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000660.x-1167s1c1
Sequence:CCGGCCCGCGTGCTAATGGTGGAAACTCGAGTTTCCACCATTAGCACGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000660.x-1189s1c1
Sequence:CCGGCCACAACGAAATCTATGACAACTCGAGTTGTCATAGATTTCGTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000660.x-1213s1c1
Sequence:CCGGCAAGCAGAGTACACACAGCATCTCGAGATGCTGTGTGTACTCTGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000660.x-1606s1c1
Sequence:CCGGCCGGCCTTTCCTGCTTCTCATCTCGAGATGAGAAGCAGGAAAGGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000660.3-1629s21c1
Sequence:CCGGCCGGCCTTTCCTGCTTCTCATCTCGAGATGAGAAGCAGGAAAGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000660.3-1193s21c1
Sequence:CCGGCCCGCGTGCTAATGGTGGAAACTCGAGTTTCCACCATTAGCACGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000660.3-1239s21c1
Sequence:CCGGCAAGCAGAGTACACACAGCATCTCGAGATGCTGTGTGTACTCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000660.3-1215s21c1
Sequence:CCGGCCACAACGAAATCTATGACAACTCGAGTTGTCATAGATTTCGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks