EMAIL THIS PAGE TO A FRIEND

TGFB1I1

transforming growth factor beta 1 induced transcript 1

Synonyms: ARA55 HIC-5 HIC5 TSC-5
UniProtKB ID: O43294, B2R8D5, Q9BPW3, Q9Y2V5
Gene ID:
Human(7041) Summary: This gene encodes a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. The encoded protein is thought to regulate androgen receptor activity and may have a role to play in the treatment of prostate cancer. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Mouse(21804) transforming growth factor beta 1 induced transcript 1
Rat(84574) transforming growth factor beta 1 induced transcript 1
Horse(100063161) transforming growth factor beta 1 induced transcript 1
domestic cat(101087440) transforming growth factor beta 1 induced transcript 1
dog(489932) transforming growth factor beta 1 induced transcript 1
cow(515834) transforming growth factor beta 1 induced transcript 1
sheep(101106385) transforming growth factor beta 1 induced transcript 1
Goat(100861032) transforming growth factor beta 1 induced transcript 1
Domestic Rabbit(100340706) transforming growth factor beta 1 induced transcript 1
naked mole-rat(101722120) transforming growth factor beta 1 induced transcript 1
domestic guinea pig(100719547) transforming growth factor beta 1 induced transcript 1
113 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015927 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015927 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015927 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009365 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009365 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009365 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042454 Rosetta Predictions human pricing
NM_015927 Rosetta Predictions human pricing
XM_001077389 Rosetta Predictions rat pricing
XM_001079227 Rosetta Predictions rat pricing
XM_001079262 Rosetta Predictions rat pricing
XM_341934 Rosetta Predictions rat pricing
NM_009365 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042454 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309878 predicted 773
2 SASI_Hs02_00309879 predicted 817
3 SASI_Hs02_00309880 predicted 1134
4 SASI_Hs02_00309881 predicted 1286
5 SASI_Hs02_00309882 predicted 951
6 SASI_Hs02_00309883 predicted 485
7 SASI_Hs02_00309884 predicted 891
8 SASI_Hs02_00309885 predicted 1124
9 SASI_Hs02_00309886 predicted 325
10 SASI_Hs02_00309887 predicted 401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015927 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095228 predicted 781
2 SASI_Hs02_00348550 predicted 820
3 SASI_Hs01_00095229 predicted 1147
4 SASI_Hs01_00095231 predicted 1294
5 SASI_Hs01_00095232 predicted 956
6 SASI_Hs01_00095234 predicted 488
7 SASI_Hs01_00095235 predicted 901
8 SASI_Hs02_00348551 predicted 1132
9 SASI_Hs02_00348552 predicted 339
10 SASI_Hs02_00348553 predicted 410
11 SASI_Hs01_00095230 predicted 1319
12 SASI_Hs01_00095233 predicted 529
13 SASI_Hs01_00095236 predicted 320
14 SASI_Hs01_00095237 predicted 957
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077389 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00356891 predicted 1245
2 SASI_Rn02_00356892 predicted 1123
3 SASI_Rn02_00356893 predicted 1004
4 SASI_Rn02_00356894 predicted 257
5 SASI_Rn02_00356895 predicted 383
6 SASI_Rn02_00356896 predicted 226
7 SASI_Rn02_00356897 predicted 1172
8 SASI_Rn02_00356898 predicted 641
9 SASI_Rn02_00356899 predicted 760
10 SASI_Rn02_00356900 predicted 599
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079227 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00363573 predicted 1246
2 SASI_Rn02_00363574 predicted 1118
3 SASI_Rn02_00363575 predicted 1003
4 SASI_Rn02_00363576 predicted 258
5 SASI_Rn02_00363577 predicted 382
6 SASI_Rn02_00363578 predicted 221
7 SASI_Rn02_00363579 predicted 1164
8 SASI_Rn02_00363580 predicted 644
9 SASI_Rn02_00363581 predicted 754
10 SASI_Rn02_00363582 predicted 598
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079262 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00363715 predicted 1264
2 SASI_Rn02_00363716 predicted 1143
3 SASI_Rn02_00363717 predicted 400
4 SASI_Rn02_00363718 predicted 361
5 SASI_Rn02_00363719 predicted 1314
6 SASI_Rn02_00363720 predicted 300
7 SASI_Rn02_00363721 predicted 782
8 SASI_Rn02_00363722 predicted 898
9 SASI_Rn02_00363723 predicted 747
10 SASI_Rn02_00363724 predicted 1297
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341934 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393593 predicted 1266
2 SASI_Rn02_00393594 predicted 1149
3 SASI_Rn02_00393595 predicted 399
4 SASI_Rn02_00393596 predicted 363
5 SASI_Rn02_00393597 predicted 1313
6 SASI_Rn02_00393598 predicted 293
7 SASI_Rn02_00393599 predicted 787
8 SASI_Rn02_00393600 predicted 895
9 SASI_Rn02_00393601 predicted 742
10 SASI_Rn02_00393602 predicted 1295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009365 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093632 predicted 1624
2 SASI_Mm01_00093633 predicted 1745
3 SASI_Mm01_00093634 predicted 2040
4 SASI_Mm01_00093635 predicted 2565
5 SASI_Mm02_00315973 predicted 1749
6 SASI_Mm01_00093636 predicted 2401
7 SASI_Mm01_00093637 predicted 1665
8 SASI_Mm01_00093638 predicted 2142
9 SASI_Mm01_00093640 predicted 1887
10 SASI_Mm01_00093641 predicted 1557
11 SASI_Mm01_00093639 predicted 2585
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015927
VALIDATED
TGFB1I1 MISSION shRNA Bacterial Glycerol Stock
transforming growth factor beta 1 induced transcript 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_015927.3-316s21c1
Sequence:CCGGCGGTTGCTTCAGGAACTTAATCTCGAGATTAAGTTCCTGAAGCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_015927.3-343s21c1
Sequence:CCGGCAGTTCAACATCACAGATGAACTCGAGTTCATCTGTGATGTTGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_015927.3-1392s21c1
Sequence:CCGGGCCCTGCTTCCTGAAGCTCTTCTCGAGAAGAGCTTCAGGAAGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_015927.3-906s21c1
Sequence:CCGGCCAGCCCATCCGACACAAGATCTCGAGATCTTGTGTCGGATGGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015927.3-316s1c1
Sequence:CCGGCGGTTGCTTCAGGAACTTAATCTCGAGATTAAGTTCCTGAAGCAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015927.3-343s1c1
Sequence:CCGGCAGTTCAACATCACAGATGAACTCGAGTTCATCTGTGATGTTGAACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_015927.3-906s1c1
Sequence:CCGGCCAGCCCATCCGACACAAGATCTCGAGATCTTGTGTCGGATGGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015927.3-527s1c1
Sequence:CCGGTCTCTGACTTCCGCGTTCAAACTCGAGTTTGAACGCGGAAGTCAGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015927
VALIDATED
TGFB1I1 MISSION shRNA shRNA Plasmid DNA
transforming growth factor beta 1 induced transcript 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_015927.3-316s21c1
Sequence:CCGGCGGTTGCTTCAGGAACTTAATCTCGAGATTAAGTTCCTGAAGCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_015927.3-343s21c1
Sequence:CCGGCAGTTCAACATCACAGATGAACTCGAGTTCATCTGTGATGTTGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_015927.3-1392s21c1
Sequence:CCGGGCCCTGCTTCCTGAAGCTCTTCTCGAGAAGAGCTTCAGGAAGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_015927.3-906s21c1
Sequence:CCGGCCAGCCCATCCGACACAAGATCTCGAGATCTTGTGTCGGATGGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015927.3-316s1c1
Sequence:CCGGCGGTTGCTTCAGGAACTTAATCTCGAGATTAAGTTCCTGAAGCAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015927.3-343s1c1
Sequence:CCGGCAGTTCAACATCACAGATGAACTCGAGTTCATCTGTGATGTTGAACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_015927.3-906s1c1
Sequence:CCGGCCAGCCCATCCGACACAAGATCTCGAGATCTTGTGTCGGATGGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015927.3-527s1c1
Sequence:CCGGTCTCTGACTTCCGCGTTCAAACTCGAGTTTGAACGCGGAAGTCAGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015927
VALIDATED
TGFB1I1 MISSION shRNA Lentiviral Transduction Particles
transforming growth factor beta 1 induced transcript 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_015927.3-316s21c1
Sequence:CCGGCGGTTGCTTCAGGAACTTAATCTCGAGATTAAGTTCCTGAAGCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_015927.3-343s21c1
Sequence:CCGGCAGTTCAACATCACAGATGAACTCGAGTTCATCTGTGATGTTGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_015927.3-1392s21c1
Sequence:CCGGGCCCTGCTTCCTGAAGCTCTTCTCGAGAAGAGCTTCAGGAAGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_015927.3-906s21c1
Sequence:CCGGCCAGCCCATCCGACACAAGATCTCGAGATCTTGTGTCGGATGGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015927.3-316s1c1
Sequence:CCGGCGGTTGCTTCAGGAACTTAATCTCGAGATTAAGTTCCTGAAGCAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015927.3-343s1c1
Sequence:CCGGCAGTTCAACATCACAGATGAACTCGAGTTCATCTGTGATGTTGAACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_015927.3-906s1c1
Sequence:CCGGCCAGCCCATCCGACACAAGATCTCGAGATCTTGTGTCGGATGGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015927.3-527s1c1
Sequence:CCGGTCTCTGACTTCCGCGTTCAAACTCGAGTTTGAACGCGGAAGTCAGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009365
TGFB1I1 MISSION shRNA Bacterial Glycerol Stock
transforming growth factor beta 1 induced transcript 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009365.2-2885s1c1
Sequence:CCGGCCTGGAATGTAGCTCTCACTTCTCGAGAAGTGAGAGCTACATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009365.2-1570s1c1
Sequence:CCGGCTAGACCGTTTGCTTCAGGAACTCGAGTTCCTGAAGCAAACGGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009365.2-1573s1c1
Sequence:CCGGGACCGTTTGCTTCAGGAACTTCTCGAGAAGTTCCTGAAGCAAACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009365.2-2571s1c1
Sequence:CCGGAGACCACTTCACCTGCACATTCTCGAGAATGTGCAGGTGAAGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009365.2-2145s1c1
Sequence:CCGGCCCACGATGTGGCTTCTGTAACTCGAGTTACAGAAGCCACATCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009365
TGFB1I1 MISSION shRNA shRNA Plasmid DNA
transforming growth factor beta 1 induced transcript 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009365.2-2885s1c1
Sequence:CCGGCCTGGAATGTAGCTCTCACTTCTCGAGAAGTGAGAGCTACATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009365.2-1570s1c1
Sequence:CCGGCTAGACCGTTTGCTTCAGGAACTCGAGTTCCTGAAGCAAACGGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009365.2-1573s1c1
Sequence:CCGGGACCGTTTGCTTCAGGAACTTCTCGAGAAGTTCCTGAAGCAAACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009365.2-2571s1c1
Sequence:CCGGAGACCACTTCACCTGCACATTCTCGAGAATGTGCAGGTGAAGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009365.2-2145s1c1
Sequence:CCGGCCCACGATGTGGCTTCTGTAACTCGAGTTACAGAAGCCACATCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009365
TGFB1I1 MISSION shRNA Lentiviral Transduction Particles
transforming growth factor beta 1 induced transcript 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009365.2-2885s1c1
Sequence:CCGGCCTGGAATGTAGCTCTCACTTCTCGAGAAGTGAGAGCTACATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009365.2-1570s1c1
Sequence:CCGGCTAGACCGTTTGCTTCAGGAACTCGAGTTCCTGAAGCAAACGGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009365.2-1573s1c1
Sequence:CCGGGACCGTTTGCTTCAGGAACTTCTCGAGAAGTTCCTGAAGCAAACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009365.2-2571s1c1
Sequence:CCGGAGACCACTTCACCTGCACATTCTCGAGAATGTGCAGGTGAAGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009365.2-2145s1c1
Sequence:CCGGCCCACGATGTGGCTTCTGTAACTCGAGTTACAGAAGCCACATCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks