EMAIL THIS PAGE TO A FRIEND

TGFB2

transforming growth factor, beta 2

Synonyms: LDS4 TGF-beta2
UniProtKB ID: P61812, B4DKC5, P08112, Q15579, Q15581, Q4VAV9
Gene ID:
Human(7042) Summary: This gene encodes a member of the transforming growth factor beta (TGFB) family of cytokines, which are multifunctional peptides that regulate proliferation, differentiation, adhesion, migration, and other functions in many cell types by transducing their signal through combinations of transmembrane type I and type II receptors (TGFBR1 and TGFBR2) and their downstream effectors, the SMAD proteins. Disruption of the TGFB/SMAD pathway has been implicated in a variety of human cancers. The encoded protein is secreted and has suppressive effects of interleukin-2 dependent T-cell growth. Translocation t(1;7)(q41;p21) between this gene and HDAC9 is associated with Peters' anomaly, a congenital defect of the anterior chamber of the eye. The knockout mice lacking this gene show perinatal mortality and a wide range of developmental, including cardiac, defects. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Sep 2010]
Mouse(21808) transforming growth factor, beta 2
Rat(81809) transforming growth factor, beta 2
domestic guinea pig(100720726) transforming growth factor, beta 2
naked mole-rat(101707457) transforming growth factor, beta 2
Domestic Rabbit(100009371) transforming growth factor, beta 2
cow(534069) transforming growth factor, beta 2
sheep(554322) transforming growth factor, beta 2
Zebrafish(369194) transforming growth factor, beta 2
chicken(421352) transforming growth factor, beta 2
domestic cat(101093414) transforming growth factor, beta 2
dog(488596) transforming growth factor, beta 2
Gene Class: Cytokines_and_Chemokines
120 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009367 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009367 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009367 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003238 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003238 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003238 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003238 Rosetta Predictions human pricing
NM_031131 Rosetta Predictions rat pricing
NM_009367 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003238 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043660 predicted 659
2 SASI_Hs01_00043661 predicted 583
3 SASI_Hs02_00335272 predicted 538
4 SASI_Hs01_00043662 predicted 765
5 SASI_Hs01_00043663 predicted 554
6 SASI_Hs01_00043664 predicted 714
7 SASI_Hs01_00043665 predicted 535
8 SASI_Hs01_00043666 predicted 619
9 SASI_Hs01_00043667 predicted 670
10 SASI_Hs01_00043668 predicted 1222
11 SASI_Hs01_00043669 predicted 727
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031131 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036090 predicted 1072
2 SASI_Rn02_00264452 predicted 1472
3 SASI_Rn01_00036093 predicted 1403
4 SASI_Rn01_00036094 predicted 1304
5 SASI_Rn01_00036095 predicted 933
6 SASI_Rn02_00264453 predicted 1435
7 SASI_Rn02_00264454 predicted 882
8 SASI_Rn01_00036098 predicted 828
9 SASI_Rn02_00264455 predicted 813
10 SASI_Rn02_00264456 predicted 305
11 SASI_Rn01_00036091 predicted 880
12 SASI_Rn01_00036092 predicted 880
13 SASI_Rn01_00036096 predicted 1162
14 SASI_Rn01_00036097 predicted 1445
15 SASI_Rn01_00036099 predicted 892
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009367 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038392 predicted 1895
2 SASI_Mm01_00038393 predicted 2005
3 SASI_Mm01_00038394 predicted 1706
4 SASI_Mm01_00038395 predicted 2059
5 SASI_Mm01_00038396 predicted 1962
6 SASI_Mm01_00038397 predicted 1799
7 SASI_Mm01_00038398 predicted 2113
8 SASI_Mm01_00038399 predicted 2262
9 SASI_Mm01_00038400 predicted 2202
10 SASI_Mm01_00038401 predicted 2292
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009367
VALIDATED
TGFB2 MISSION shRNA Bacterial Glycerol Stock
transforming growth factor, beta 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009367.1-1607s1c1
Sequence:CCGGCCGCTTTGATGTCTCAACAATCTCGAGATTGTTGAGACATCAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009367.1-1913s1c1
Sequence:CCGGGCCGTCTAATAATTACATCATCTCGAGATGATGTAATTATTAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009367.1-1294s1c1
Sequence:CCGGCCCTCGACATGGATCAGTTTACTCGAGTAAACTGATCCATGTCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009367.1-2423s1c1
Sequence:CCGGGCTTTCCAATATGATTGTCAACTCGAGTTGACAATCATATTGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009367.1-3313s1c1
Sequence:CCGGCGGTGAAATGTTGACCTGTTTCTCGAGAAACAGGTCAACATTTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009367.3-1958s21c1
Sequence:CCGGAGGCGAGATTTGCAGGTATTGCTCGAGCAATACCTGCAAATCTCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009367.3-1510s21c1
Sequence:CCGGTACTACGCCAAGGAGGTTTATCTCGAGATAAACCTCCTTGGCGTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009367.3-1914s21c1
Sequence:CCGGGCCGTCTAATAATTACATCATCTCGAGATGATGTAATTATTAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312105    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009367.3-3314s21c1
Sequence:CCGGCGGTGAAATGTTGACCTGTTTCTCGAGAAACAGGTCAACATTTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009367.3-2311s21c1
Sequence:CCGGAGCCTGTACAACACCATAAATCTCGAGATTTATGGTGTTGTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009367
VALIDATED
TGFB2 MISSION shRNA shRNA Plasmid DNA
transforming growth factor, beta 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009367.1-1607s1c1
Sequence:CCGGCCGCTTTGATGTCTCAACAATCTCGAGATTGTTGAGACATCAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009367.1-1913s1c1
Sequence:CCGGGCCGTCTAATAATTACATCATCTCGAGATGATGTAATTATTAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009367.1-1294s1c1
Sequence:CCGGCCCTCGACATGGATCAGTTTACTCGAGTAAACTGATCCATGTCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009367.1-2423s1c1
Sequence:CCGGGCTTTCCAATATGATTGTCAACTCGAGTTGACAATCATATTGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009367.1-3313s1c1
Sequence:CCGGCGGTGAAATGTTGACCTGTTTCTCGAGAAACAGGTCAACATTTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009367.3-1958s21c1
Sequence:CCGGAGGCGAGATTTGCAGGTATTGCTCGAGCAATACCTGCAAATCTCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009367.3-1510s21c1
Sequence:CCGGTACTACGCCAAGGAGGTTTATCTCGAGATAAACCTCCTTGGCGTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009367.3-1914s21c1
Sequence:CCGGGCCGTCTAATAATTACATCATCTCGAGATGATGTAATTATTAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312105    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009367.3-3314s21c1
Sequence:CCGGCGGTGAAATGTTGACCTGTTTCTCGAGAAACAGGTCAACATTTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009367.3-2311s21c1
Sequence:CCGGAGCCTGTACAACACCATAAATCTCGAGATTTATGGTGTTGTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009367
VALIDATED
TGFB2 MISSION shRNA Lentiviral Transduction Particles
transforming growth factor, beta 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009367.1-1607s1c1
Sequence:CCGGCCGCTTTGATGTCTCAACAATCTCGAGATTGTTGAGACATCAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009367.1-1913s1c1
Sequence:CCGGGCCGTCTAATAATTACATCATCTCGAGATGATGTAATTATTAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009367.1-1294s1c1
Sequence:CCGGCCCTCGACATGGATCAGTTTACTCGAGTAAACTGATCCATGTCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009367.1-2423s1c1
Sequence:CCGGGCTTTCCAATATGATTGTCAACTCGAGTTGACAATCATATTGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009367.1-3313s1c1
Sequence:CCGGCGGTGAAATGTTGACCTGTTTCTCGAGAAACAGGTCAACATTTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009367.3-1958s21c1
Sequence:CCGGAGGCGAGATTTGCAGGTATTGCTCGAGCAATACCTGCAAATCTCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009367.3-1510s21c1
Sequence:CCGGTACTACGCCAAGGAGGTTTATCTCGAGATAAACCTCCTTGGCGTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009367.3-1914s21c1
Sequence:CCGGGCCGTCTAATAATTACATCATCTCGAGATGATGTAATTATTAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312105    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009367.3-3314s21c1
Sequence:CCGGCGGTGAAATGTTGACCTGTTTCTCGAGAAACAGGTCAACATTTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009367.3-2311s21c1
Sequence:CCGGAGCCTGTACAACACCATAAATCTCGAGATTTATGGTGTTGTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003238
VALIDATED
TGFB2 MISSION shRNA Bacterial Glycerol Stock
transforming growth factor, beta 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003238.1-1097s1c1
Sequence:CCGGGCGGCCTATTGCTTTAGAAATCTCGAGATTTCTAAAGCAATAGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003238.1-1374s1c1
Sequence:CCGGCCAAGATTGAACAGCTTTCTACTCGAGTAGAAAGCTGTTCAATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003238.1-256s1c1
Sequence:CCGGCACACTCGATATGGACCAGTTCTCGAGAACTGGTCCATATCGAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003238.1-674s1c1
Sequence:CCGGCGGATTGAGCTATATCAGATTCTCGAGAATCTGATATAGCTCAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003238.2-1660s21c1
Sequence:CCGGACGAACCCAAAGGGTACAATGCTCGAGCATTGTACCCTTTGGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003238.2-1601s21c1
Sequence:CCGGTTGCTGCCTACGTCCACTTTACTCGAGTAAAGTGGACGTAGGCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003238.2-1692s21c1
Sequence:CCGGGCTGGAGCATGCCCGTATTTACTCGAGTAAATACGGGCATGCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003238
VALIDATED
TGFB2 MISSION shRNA shRNA Plasmid DNA
transforming growth factor, beta 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003238.1-1097s1c1
Sequence:CCGGGCGGCCTATTGCTTTAGAAATCTCGAGATTTCTAAAGCAATAGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003238.1-1374s1c1
Sequence:CCGGCCAAGATTGAACAGCTTTCTACTCGAGTAGAAAGCTGTTCAATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003238.1-256s1c1
Sequence:CCGGCACACTCGATATGGACCAGTTCTCGAGAACTGGTCCATATCGAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003238.1-674s1c1
Sequence:CCGGCGGATTGAGCTATATCAGATTCTCGAGAATCTGATATAGCTCAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003238.2-1660s21c1
Sequence:CCGGACGAACCCAAAGGGTACAATGCTCGAGCATTGTACCCTTTGGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003238.2-1601s21c1
Sequence:CCGGTTGCTGCCTACGTCCACTTTACTCGAGTAAAGTGGACGTAGGCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003238.2-1692s21c1
Sequence:CCGGGCTGGAGCATGCCCGTATTTACTCGAGTAAATACGGGCATGCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003238
VALIDATED
TGFB2 MISSION shRNA Lentiviral Transduction Particles
transforming growth factor, beta 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003238.1-1097s1c1
Sequence:CCGGGCGGCCTATTGCTTTAGAAATCTCGAGATTTCTAAAGCAATAGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003238.1-1374s1c1
Sequence:CCGGCCAAGATTGAACAGCTTTCTACTCGAGTAGAAAGCTGTTCAATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003238.1-256s1c1
Sequence:CCGGCACACTCGATATGGACCAGTTCTCGAGAACTGGTCCATATCGAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003238.1-674s1c1
Sequence:CCGGCGGATTGAGCTATATCAGATTCTCGAGAATCTGATATAGCTCAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003238.2-1660s21c1
Sequence:CCGGACGAACCCAAAGGGTACAATGCTCGAGCATTGTACCCTTTGGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003238.2-1601s21c1
Sequence:CCGGTTGCTGCCTACGTCCACTTTACTCGAGTAAAGTGGACGTAGGCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003238.2-1692s21c1
Sequence:CCGGGCTGGAGCATGCCCGTATTTACTCGAGTAAATACGGGCATGCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks