EMAIL THIS PAGE TO A FRIEND

TGFB3

transforming growth factor, beta 3

Synonyms: ARVD TGF-beta3
UniProtKB ID: P10600
Gene ID:
Human(7043) Summary: This gene encodes a member of the TGF-beta family of proteins. The encoded protein is secreted and is involved in embryogenesis and cell differentiation. Defects in this gene are a cause of familial arrhythmogenic right ventricular dysplasia 1. [provided by RefSeq, Mar 2009]
Mouse(21809) transforming growth factor, beta 3
Rat(25717) transforming growth factor, beta 3
Zebrafish(369195) transforming growth factor, beta 3
chicken(396438) transforming growth factor, beta 3
domestic cat(101098469) transforming growth factor, beta 3
Horse(100051765) transforming growth factor, beta 3
dog(490796) transforming growth factor, beta 3
cow(538957) transforming growth factor, beta 3
sheep(554323) transforming growth factor, beta 3
Domestic Rabbit(100358982) transforming growth factor, beta 3
naked mole-rat(101712904) transforming growth factor, beta 3
domestic guinea pig(100715426) transforming growth factor, beta 3
104 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003239 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003239 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003239 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009368 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009368 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009368 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003239 Rosetta Predictions human pricing
NM_013174 Rosetta Predictions rat pricing
NM_009368 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003239 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228334 predicted 1508
2 SASI_Hs01_00228336 predicted 1765
3 SASI_Hs02_00335273 predicted 1405
4 SASI_Hs01_00228337 predicted 1498
5 SASI_Hs02_00335274 predicted 1329
6 SASI_Hs02_00335275 predicted 1283
7 SASI_Hs01_00228338 predicted 1526
8 SASI_Hs01_00228339 predicted 2164
9 SASI_Hs01_00228341 predicted 1488
10 SASI_Hs01_00228342 predicted 1162
11 SASI_Hs01_00228335 predicted 1085
12 SASI_Hs01_00228340 predicted 1518
13 SASI_Hs01_00228343 predicted 783
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013174 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074496 predicted 922
2 SASI_Rn01_00074497 predicted 1552
3 SASI_Rn01_00074498 predicted 766
4 SASI_Rn01_00074499 predicted 1046
5 SASI_Rn01_00074500 predicted 701
6 SASI_Rn01_00074501 predicted 1234
7 SASI_Rn01_00074502 predicted 827
8 SASI_Rn01_00074503 predicted 1383
9 SASI_Rn01_00074504 predicted 897
10 SASI_Rn01_00074505 predicted 1699
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009368 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315974 predicted 2051
2 SASI_Mm01_00180187 predicted 1231
3 SASI_Mm01_00180188 predicted 1755
4 SASI_Mm01_00180189 predicted 994
5 SASI_Mm01_00180190 predicted 1244
6 SASI_Mm01_00180192 predicted 1582
7 SASI_Mm01_00180193 predicted 603
8 SASI_Mm01_00180194 predicted 970
9 SASI_Mm01_00180195 predicted 797
10 SASI_Mm01_00180196 predicted 1608
11 SASI_Mm01_00180191 predicted 1349
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003239
TGFB3 MISSION shRNA Bacterial Glycerol Stock
transforming growth factor, beta 3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003239.2-2524s21c1
Sequence:CCGGGCTCTAGGGAATCTGGATTATCTCGAGATAATCCAGATTCCCTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003239.2-1393s21c1
Sequence:CCGGCATTGCCAAACAGCGCTATATCTCGAGATATAGCGCTGTTTGGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003239.1-684s1c1
Sequence:CCGGCCAACCTATTCCGAGCAGAATCTCGAGATTCTGCTCGGAATAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003239.1-1078s1c1
Sequence:CCGGCCCTCATCTAATCCTCATGATCTCGAGATCATGAGGATTAGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003239.1-886s1c1
Sequence:CCGGGCTGTTGAGAAGAGAGTCCAACTCGAGTTGGACTCTCTTCTCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003239.1-546s1c1
Sequence:CCGGCGGAATACTATGCCAAAGAAACTCGAGTTTCTTTGGCATAGTATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003239
TGFB3 MISSION shRNA shRNA Plasmid DNA
transforming growth factor, beta 3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003239.2-2524s21c1
Sequence:CCGGGCTCTAGGGAATCTGGATTATCTCGAGATAATCCAGATTCCCTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003239.2-1393s21c1
Sequence:CCGGCATTGCCAAACAGCGCTATATCTCGAGATATAGCGCTGTTTGGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003239.1-684s1c1
Sequence:CCGGCCAACCTATTCCGAGCAGAATCTCGAGATTCTGCTCGGAATAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003239.1-1078s1c1
Sequence:CCGGCCCTCATCTAATCCTCATGATCTCGAGATCATGAGGATTAGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003239.1-886s1c1
Sequence:CCGGGCTGTTGAGAAGAGAGTCCAACTCGAGTTGGACTCTCTTCTCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003239.1-546s1c1
Sequence:CCGGCGGAATACTATGCCAAAGAAACTCGAGTTTCTTTGGCATAGTATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003239
TGFB3 MISSION shRNA Lentiviral Transduction Particles
transforming growth factor, beta 3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003239.2-2524s21c1
Sequence:CCGGGCTCTAGGGAATCTGGATTATCTCGAGATAATCCAGATTCCCTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003239.2-1393s21c1
Sequence:CCGGCATTGCCAAACAGCGCTATATCTCGAGATATAGCGCTGTTTGGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003239.1-684s1c1
Sequence:CCGGCCAACCTATTCCGAGCAGAATCTCGAGATTCTGCTCGGAATAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003239.1-1078s1c1
Sequence:CCGGCCCTCATCTAATCCTCATGATCTCGAGATCATGAGGATTAGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003239.1-886s1c1
Sequence:CCGGGCTGTTGAGAAGAGAGTCCAACTCGAGTTGGACTCTCTTCTCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003239.1-546s1c1
Sequence:CCGGCGGAATACTATGCCAAAGAAACTCGAGTTTCTTTGGCATAGTATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009368
VALIDATED
TGFB3 MISSION shRNA Bacterial Glycerol Stock
transforming growth factor, beta 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009368.1-1154s1c1
Sequence:CCGGCGCTACATAGGTGGCAAGAATCTCGAGATTCTTGCCACCTATGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009368.1-1603s1c1
Sequence:CCGGCCACGAACCTAAGGGTTACTACTCGAGTAGTAACCCTTAGGTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009368.1-1361s1c1
Sequence:CCGGGTGGACAATGAAGATGACCATCTCGAGATGGTCATCTTCATTGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009368.1-1813s1c1
Sequence:CCGGCATGGTGGTGAAGTCGTGTAACTCGAGTTACACGACTTCACCACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009368.1-916s1c1
Sequence:CCGGGATCCATAAATTCGACATGATCTCGAGATCATGTCGAATTTATGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009368
VALIDATED
TGFB3 MISSION shRNA shRNA Plasmid DNA
transforming growth factor, beta 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009368.1-1154s1c1
Sequence:CCGGCGCTACATAGGTGGCAAGAATCTCGAGATTCTTGCCACCTATGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009368.1-1603s1c1
Sequence:CCGGCCACGAACCTAAGGGTTACTACTCGAGTAGTAACCCTTAGGTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009368.1-1361s1c1
Sequence:CCGGGTGGACAATGAAGATGACCATCTCGAGATGGTCATCTTCATTGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009368.1-1813s1c1
Sequence:CCGGCATGGTGGTGAAGTCGTGTAACTCGAGTTACACGACTTCACCACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009368.1-916s1c1
Sequence:CCGGGATCCATAAATTCGACATGATCTCGAGATCATGTCGAATTTATGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009368
VALIDATED
TGFB3 MISSION shRNA Lentiviral Transduction Particles
transforming growth factor, beta 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009368.1-1154s1c1
Sequence:CCGGCGCTACATAGGTGGCAAGAATCTCGAGATTCTTGCCACCTATGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009368.1-1603s1c1
Sequence:CCGGCCACGAACCTAAGGGTTACTACTCGAGTAGTAACCCTTAGGTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009368.1-1361s1c1
Sequence:CCGGGTGGACAATGAAGATGACCATCTCGAGATGGTCATCTTCATTGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009368.1-1813s1c1
Sequence:CCGGCATGGTGGTGAAGTCGTGTAACTCGAGTTACACGACTTCACCACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009368.1-916s1c1
Sequence:CCGGGATCCATAAATTCGACATGATCTCGAGATCATGTCGAATTTATGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks