EMAIL THIS PAGE TO A FRIEND

TGFBI

transforming growth factor, beta-induced, 68kDa

Synonyms: BIGH3 CDB1 CDG2 CDGG1 CSD CSD1 CSD2 CSD3 EBMD LCD1
Gene ID:
Human(7045) Summary: This gene encodes an RGD-containing protein that binds to type I, II and IV collagens. The RGD motif is found in many extracellular matrix proteins modulating cell adhesion and serves as a ligand recognition sequence for several integrins. This protein plays a role in cell-collagen interactions and may be involved in endochondrial bone formation in cartilage. The protein is induced by transforming growth factor-beta and acts to inhibit cell adhesion. Mutations in this gene are associated with multiple types of corneal dystrophy. [provided by RefSeq, Jul 2008]
Mouse(21810) transforming growth factor, beta induced
Rat(116487) transforming growth factor, beta induced
domestic guinea pig(100717287) transforming growth factor, beta-induced, 68kDa
naked mole-rat(101702581) transforming growth factor, beta-induced, 68kDa
Domestic Rabbit(100009230) transforming growth factor, beta-induced, 68kDa
cow(539596) transforming growth factor, beta-induced, 68kDa
sheep(101106006) transforming growth factor, beta-induced, 68kDa
Zebrafish(321421) transforming growth factor, beta-induced
domestic cat(101081357) transforming growth factor, beta-induced, 68kDa
dog(481519) transforming growth factor, beta-induced, 68kDa
chicken(395897) transforming growth factor, beta-induced, 68kDa
131 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000358 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000358 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000358 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009369 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009369 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009369 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000358 Rosetta Predictions human pricing
XM_001067964 Rosetta Predictions rat pricing
XM_573983 Rosetta Predictions rat pricing
NM_009369 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000358 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170659 predicted 1449
2 SASI_Hs01_00170660 predicted 777
3 SASI_Hs01_00170661 predicted 313
4 SASI_Hs02_00302404 predicted 2007
5 SASI_Hs01_00170663 predicted 2017
6 SASI_Hs01_00170664 predicted 2197
7 SASI_Hs01_00170665 predicted 1187
8 SASI_Hs01_00170666 predicted 2194
9 SASI_Hs01_00170667 predicted 1436
10 SASI_Hs01_00170668 predicted 1288
11 SASI_Hs01_00170662 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067964 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00322968 predicted 2210
2 SASI_Rn02_00322969 predicted 1722
3 SASI_Rn02_00322970 predicted 2078
4 SASI_Rn02_00322971 predicted 686
5 SASI_Rn02_00322972 predicted 1755
6 SASI_Rn02_00322973 predicted 1920
7 SASI_Rn02_00322974 predicted 1184
8 SASI_Rn02_00322975 predicted 2196
9 SASI_Rn02_00322976 predicted 2112
10 SASI_Rn02_00322977 predicted 1941
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573983 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401140 predicted 2200
2 SASI_Rn02_00401141 predicted 331
3 SASI_Rn02_00401142 predicted 1717
4 SASI_Rn02_00401143 predicted 2065
5 SASI_Rn02_00401144 predicted 674
6 SASI_Rn02_00401145 predicted 1748
7 SASI_Rn02_00401146 predicted 1912
8 SASI_Rn02_00401147 predicted 1166
9 SASI_Rn02_00401148 predicted 2190
10 SASI_Rn02_00401149 predicted 2106
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009369 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315975 predicted 987
2 SASI_Mm01_00114241 predicted 2087
3 SASI_Mm01_00114242 predicted 2147
4 SASI_Mm01_00114243 predicted 1735
5 SASI_Mm01_00114244 predicted 1703
6 SASI_Mm01_00114245 predicted 658
7 SASI_Mm01_00114246 predicted 1222
8 SASI_Mm01_00114247 predicted 1894
9 SASI_Mm01_00114248 predicted 1611
10 SASI_Mm01_00114249 predicted 1471
11 SASI_Mm01_00114250 predicted 1552
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000358
VALIDATED
TGFBI MISSION shRNA Bacterial Glycerol Stock
transforming growth factor, beta-induced, 68kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000358.1-1380s1c1
Sequence:CCGGGCCTCTAAGTATCTGTACCATCTCGAGATGGTACAGATACTTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000358.1-1995s1c1
Sequence:CCGGGCGCTTGAGATCTTCAAACAACTCGAGTTGTTTGAAGATCTCAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000358.1-617s1c1
Sequence:CCGGCCTCACCTCTATGTACCAGAACTCGAGTTCTGGTACATAGAGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000358.1-202s1c1
Sequence:CCGGAGAAGGTTATTGGCACTAATACTCGAGTATTAGTGCCAATAACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000358.1-974s1c1
Sequence:CCGGCCACATCTTGAAGTCAGCTATCTCGAGATAGCTGACTTCAAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000358.2-316s21c1
Sequence:CCGGAGAAGGTTATTGGCACTAATACTCGAGTATTAGTGCCAATAACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000358.2-1088s21c1
Sequence:CCGGCCACATCTTGAAGTCAGCTATCTCGAGATAGCTGACTTCAAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000358.2-2109s21c1
Sequence:CCGGGCGCTTGAGATCTTCAAACAACTCGAGTTGTTTGAAGATCTCAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000358.2-1494s21c1
Sequence:CCGGGCCTCTAAGTATCTGTACCATCTCGAGATGGTACAGATACTTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000358
VALIDATED
TGFBI MISSION shRNA shRNA Plasmid DNA
transforming growth factor, beta-induced, 68kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000358.1-1380s1c1
Sequence:CCGGGCCTCTAAGTATCTGTACCATCTCGAGATGGTACAGATACTTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000358.1-1995s1c1
Sequence:CCGGGCGCTTGAGATCTTCAAACAACTCGAGTTGTTTGAAGATCTCAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000358.1-617s1c1
Sequence:CCGGCCTCACCTCTATGTACCAGAACTCGAGTTCTGGTACATAGAGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000358.1-202s1c1
Sequence:CCGGAGAAGGTTATTGGCACTAATACTCGAGTATTAGTGCCAATAACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000358.1-974s1c1
Sequence:CCGGCCACATCTTGAAGTCAGCTATCTCGAGATAGCTGACTTCAAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000358.2-316s21c1
Sequence:CCGGAGAAGGTTATTGGCACTAATACTCGAGTATTAGTGCCAATAACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000358.2-1088s21c1
Sequence:CCGGCCACATCTTGAAGTCAGCTATCTCGAGATAGCTGACTTCAAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000358.2-2109s21c1
Sequence:CCGGGCGCTTGAGATCTTCAAACAACTCGAGTTGTTTGAAGATCTCAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000358.2-1494s21c1
Sequence:CCGGGCCTCTAAGTATCTGTACCATCTCGAGATGGTACAGATACTTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000358
VALIDATED
TGFBI MISSION shRNA Lentiviral Transduction Particles
transforming growth factor, beta-induced, 68kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000358.1-1380s1c1
Sequence:CCGGGCCTCTAAGTATCTGTACCATCTCGAGATGGTACAGATACTTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000358.1-1995s1c1
Sequence:CCGGGCGCTTGAGATCTTCAAACAACTCGAGTTGTTTGAAGATCTCAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000358.1-617s1c1
Sequence:CCGGCCTCACCTCTATGTACCAGAACTCGAGTTCTGGTACATAGAGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000358.1-202s1c1
Sequence:CCGGAGAAGGTTATTGGCACTAATACTCGAGTATTAGTGCCAATAACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000358.1-974s1c1
Sequence:CCGGCCACATCTTGAAGTCAGCTATCTCGAGATAGCTGACTTCAAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000358.2-316s21c1
Sequence:CCGGAGAAGGTTATTGGCACTAATACTCGAGTATTAGTGCCAATAACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000358.2-1088s21c1
Sequence:CCGGCCACATCTTGAAGTCAGCTATCTCGAGATAGCTGACTTCAAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000358.2-2109s21c1
Sequence:CCGGGCGCTTGAGATCTTCAAACAACTCGAGTTGTTTGAAGATCTCAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000358.2-1494s21c1
Sequence:CCGGGCCTCTAAGTATCTGTACCATCTCGAGATGGTACAGATACTTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009369
VALIDATED
TGFBI MISSION shRNA Bacterial Glycerol Stock
transforming growth factor, beta-induced, 68kDa
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054808    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009369.1-2467s1c1
Sequence:CCGGGCCTTGGCATGGTTCTGTAAACTCGAGTTTACAGAACCATGCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009369.1-661s1c1
Sequence:CCGGCCCAATGGGATTGTAACTGTTCTCGAGAACAGTTACAATCCCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009369.1-1696s1c1
Sequence:CCGGCCTCCAGAAGAACTGAACAAACTCGAGTTTGTTCAGTTCTTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009369.1-1435s1c1
Sequence:CCGGCGAGTCTTTGTTTATCGAAATCTCGAGATTTCGATAAACAAAGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009369.1-1216s1c1
Sequence:CCGGGCCATTGACATCCTCAAACAACTCGAGTTGTTTGAGGATGTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009369.4-2005s21c1
Sequence:CCGGTCAAACAGGCGTCAGCGTATTCTCGAGAATACGCTGACGCCTGTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009369.4-2201s21c1
Sequence:CCGGATACATGGGCTGCACCATATTCTCGAGAATATGGTGCAGCCCATGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009369
VALIDATED
TGFBI MISSION shRNA shRNA Plasmid DNA
transforming growth factor, beta-induced, 68kDa
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054808    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009369.1-2467s1c1
Sequence:CCGGGCCTTGGCATGGTTCTGTAAACTCGAGTTTACAGAACCATGCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009369.1-661s1c1
Sequence:CCGGCCCAATGGGATTGTAACTGTTCTCGAGAACAGTTACAATCCCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009369.1-1696s1c1
Sequence:CCGGCCTCCAGAAGAACTGAACAAACTCGAGTTTGTTCAGTTCTTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009369.1-1435s1c1
Sequence:CCGGCGAGTCTTTGTTTATCGAAATCTCGAGATTTCGATAAACAAAGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009369.1-1216s1c1
Sequence:CCGGGCCATTGACATCCTCAAACAACTCGAGTTGTTTGAGGATGTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009369.4-2005s21c1
Sequence:CCGGTCAAACAGGCGTCAGCGTATTCTCGAGAATACGCTGACGCCTGTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009369.4-2201s21c1
Sequence:CCGGATACATGGGCTGCACCATATTCTCGAGAATATGGTGCAGCCCATGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009369
VALIDATED
TGFBI MISSION shRNA Lentiviral Transduction Particles
transforming growth factor, beta-induced, 68kDa
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054808    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009369.1-2467s1c1
Sequence:CCGGGCCTTGGCATGGTTCTGTAAACTCGAGTTTACAGAACCATGCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009369.1-661s1c1
Sequence:CCGGCCCAATGGGATTGTAACTGTTCTCGAGAACAGTTACAATCCCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009369.1-1696s1c1
Sequence:CCGGCCTCCAGAAGAACTGAACAAACTCGAGTTTGTTCAGTTCTTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009369.1-1435s1c1
Sequence:CCGGCGAGTCTTTGTTTATCGAAATCTCGAGATTTCGATAAACAAAGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009369.1-1216s1c1
Sequence:CCGGGCCATTGACATCCTCAAACAACTCGAGTTGTTTGAGGATGTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009369.4-2005s21c1
Sequence:CCGGTCAAACAGGCGTCAGCGTATTCTCGAGAATACGCTGACGCCTGTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009369.4-2201s21c1
Sequence:CCGGATACATGGGCTGCACCATATTCTCGAGAATATGGTGCAGCCCATGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks