EMAIL THIS PAGE TO A FRIEND

TGFBR1

transforming growth factor, beta receptor 1

Synonyms: AAT5 ACVRLK4 ALK-5 ALK5 LDS1A LDS2A MSSE SKR4 TGFR-1
UniProtKB ID: P36897, Q6IR47, Q706C0, Q706C1
Gene ID:
Human(7046) Summary: The protein encoded by this gene forms a heteromeric complex with type II TGF-beta receptors when bound to TGF-beta, transducing the TGF-beta signal from the cell surface to the cytoplasm. The encoded protein is a serine/threonine protein kinase. Mutations in this gene have been associated with Loeys-Dietz aortic aneurysm syndrome (LDAS). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Mouse(21812) transforming growth factor, beta receptor I
Rat(29591) transforming growth factor, beta receptor 1
chicken(374094) transforming growth factor, beta receptor I (activin A receptor type II-like kinase, 53kDa)
domestic cat(101094057) transforming growth factor, beta receptor 1
dog(481628) transforming growth factor, beta receptor 1
cow(282382) transforming growth factor, beta receptor 1
sheep(554326) transforming growth factor, beta receptor 1
naked mole-rat(101718090) transforming growth factor, beta receptor 1
domestic guinea pig(100715237) transforming growth factor, beta receptor 1
323 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
L6293 LY-364947 ≥98% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009370 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009370 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009370 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004612 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004612 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004612 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004612 siRNAs that have been validated in the lab human pricing
NM_012775 Rosetta Predictions rat pricing
NM_009370 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004612 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181142 validated 1518
2 SASI_Hs01_00181141 predicted 1455
3 SASI_Hs01_00181143 predicted 1162
4 SASI_Hs01_00181144 predicted 369
5 SASI_Hs02_00337998 predicted 1648
6 SASI_Hs01_00181146 predicted 1151
7 SASI_Hs01_00181147 predicted 1359
8 SASI_Hs01_00181149 predicted 401
9 SASI_Hs01_00181150 predicted 1118
10 SASI_Hs02_00337999 predicted 421
11 SASI_Hs01_00181145 predicted 1618
12 SASI_Hs01_00181148 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012775 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038290 predicted 365
2 SASI_Rn01_00038291 predicted 1472
3 SASI_Rn02_00260174 predicted 247
4 SASI_Rn01_00038292 predicted 1401
5 SASI_Rn02_00260175 predicted 317
6 SASI_Rn01_00038294 predicted 810
7 SASI_Rn01_00038295 predicted 1126
8 SASI_Rn01_00038296 predicted 312
9 SASI_Rn01_00038297 predicted 552
10 SASI_Rn01_00038298 predicted 1352
11 SASI_Rn01_00038289 predicted 1075
12 SASI_Rn01_00038293 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009370 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169048 predicted 1350
2 SASI_Mm01_00169049 predicted 1271
3 SASI_Mm01_00169050 predicted 1278
4 SASI_Mm01_00169052 predicted 296
5 SASI_Mm01_00169053 predicted 269
6 SASI_Mm01_00169054 predicted 842
7 SASI_Mm01_00169055 predicted 1546
8 SASI_Mm01_00169056 predicted 1528
9 SASI_Mm01_00169057 predicted 755
10 SASI_Mm02_00315976 predicted 1072
11 SASI_Mm01_00169051 predicted 1019
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009370
VALIDATED
TGFBR1 MISSION shRNA Bacterial Glycerol Stock
transforming growth factor, beta receptor 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000322107    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009370.2-1550s21c1
Sequence:CCGGATATCTGCTCCTGGGTGTTTACTCGAGTAAACACCCAGGAGCAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009370.2-1453s21c1
Sequence:CCGGGCTGACAGCTTTGCGAATTAACTCGAGTTAATTCGCAAAGCTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009370.2-209s21c1
Sequence:CCGGATAGCTGAAATTGACCTAATTCTCGAGAATTAGGTCAATTTCAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009370.2-743s21c1
Sequence:CCGGGCAGAGATTTATCAGACTGTACTCGAGTACAGTCTGATAAATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009370.2-426s21c1
Sequence:CCGGCACTTATGCTGATGGTCTATACTCGAGTATAGACCATCAGCATAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009370.2-743s1c1
Sequence:CCGGGCAGAGATTTATCAGACTGTACTCGAGTACAGTCTGATAAATCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009370.2-1394s1c1
Sequence:CCGGGCCTTGAGAGTGATGGCTAAACTCGAGTTTAGCCATCACTCTCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009370.2-1453s1c1
Sequence:CCGGGCTGACAGCTTTGCGAATTAACTCGAGTTAATTCGCAAAGCTGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009370.2-425s1c1
Sequence:CCGGGCACTTATGCTGATGGTCTATCTCGAGATAGACCATCAGCATAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009370.2-996s1c1
Sequence:CCGGCCCATAGAGATTTGAAATCAACTCGAGTTGATTTCAAATCTCTATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009370
VALIDATED
TGFBR1 MISSION shRNA shRNA Plasmid DNA
transforming growth factor, beta receptor 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000322107    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009370.2-1550s21c1
Sequence:CCGGATATCTGCTCCTGGGTGTTTACTCGAGTAAACACCCAGGAGCAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009370.2-1453s21c1
Sequence:CCGGGCTGACAGCTTTGCGAATTAACTCGAGTTAATTCGCAAAGCTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009370.2-209s21c1
Sequence:CCGGATAGCTGAAATTGACCTAATTCTCGAGAATTAGGTCAATTTCAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009370.2-743s21c1
Sequence:CCGGGCAGAGATTTATCAGACTGTACTCGAGTACAGTCTGATAAATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009370.2-426s21c1
Sequence:CCGGCACTTATGCTGATGGTCTATACTCGAGTATAGACCATCAGCATAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009370.2-743s1c1
Sequence:CCGGGCAGAGATTTATCAGACTGTACTCGAGTACAGTCTGATAAATCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009370.2-1394s1c1
Sequence:CCGGGCCTTGAGAGTGATGGCTAAACTCGAGTTTAGCCATCACTCTCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009370.2-1453s1c1
Sequence:CCGGGCTGACAGCTTTGCGAATTAACTCGAGTTAATTCGCAAAGCTGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009370.2-425s1c1
Sequence:CCGGGCACTTATGCTGATGGTCTATCTCGAGATAGACCATCAGCATAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009370.2-996s1c1
Sequence:CCGGCCCATAGAGATTTGAAATCAACTCGAGTTGATTTCAAATCTCTATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009370
VALIDATED
TGFBR1 MISSION shRNA Lentiviral Transduction Particles
transforming growth factor, beta receptor 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000322107    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009370.2-1550s21c1
Sequence:CCGGATATCTGCTCCTGGGTGTTTACTCGAGTAAACACCCAGGAGCAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009370.2-1453s21c1
Sequence:CCGGGCTGACAGCTTTGCGAATTAACTCGAGTTAATTCGCAAAGCTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009370.2-209s21c1
Sequence:CCGGATAGCTGAAATTGACCTAATTCTCGAGAATTAGGTCAATTTCAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009370.2-743s21c1
Sequence:CCGGGCAGAGATTTATCAGACTGTACTCGAGTACAGTCTGATAAATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009370.2-426s21c1
Sequence:CCGGCACTTATGCTGATGGTCTATACTCGAGTATAGACCATCAGCATAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009370.2-743s1c1
Sequence:CCGGGCAGAGATTTATCAGACTGTACTCGAGTACAGTCTGATAAATCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009370.2-1394s1c1
Sequence:CCGGGCCTTGAGAGTGATGGCTAAACTCGAGTTTAGCCATCACTCTCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009370.2-1453s1c1
Sequence:CCGGGCTGACAGCTTTGCGAATTAACTCGAGTTAATTCGCAAAGCTGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009370.2-425s1c1
Sequence:CCGGGCACTTATGCTGATGGTCTATCTCGAGATAGACCATCAGCATAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009370.2-996s1c1
Sequence:CCGGCCCATAGAGATTTGAAATCAACTCGAGTTGATTTCAAATCTCTATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004612
VALIDATED
TGFBR1 MISSION shRNA Bacterial Glycerol Stock
transforming growth factor, beta receptor 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004612.1-1463s1c1
Sequence:CCGGGCCTTGAGAGTAATGGCTAAACTCGAGTTTAGCCATTACTCTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004612.1-1157s1c1
Sequence:CCGGGCCACAGATACCATTGATATTCTCGAGAATATCAATGGTATCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004612.1-1316s1c1
Sequence:CCGGCGATGTTCCATTGGTGGAATTCTCGAGAATTCCACCAATGGAACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004612.1-680s1c1
Sequence:CCGGGCGAGAACTATTGTGTTACAACTCGAGTTGTAACACAATAGTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039773    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004612.1-1871s1c1
Sequence:CCGGGCTGGTCTTAACTTTAGGTAACTCGAGTTACCTAAAGTTAAGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004612.x-1493s1c1
Sequence:CCGGAATGTTGGTATGCCAATGGACTCGAGTCCATTGGCATACCAACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004612.x-2229s1c1
Sequence:CCGGCAGTAAGTGCCACTTCTGTGTCTCGAGACACAGAAGTGGCACTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004612.x-275s1c1
Sequence:CCGGCACAACAGCATGTGTATAGCTCTCGAGAGCTATACACATGCTGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196326    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004612.2-4094s1c1
Sequence:CCGGGATCATGATTACTGTCGATAACTCGAGTTATCGACAGTAATCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004612.2-758s1c1
Sequence:CCGGGAAGTTGCTGTTAAGATATTCCTCGAGGAATATCTTAACAGCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004612.2-565s1c1
Sequence:CCGGCCCTTCATTAGATCGCCCTTTCTCGAGAAAGGGCGATCTAATGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004612.2-410s1c1
Sequence:CCGGCCAACTACTGTAAAGTCATCACTCGAGTGATGACTTTACAGTAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004612.2-497s1c1
Sequence:CCGGCTCATGTTGATGGTCTATATCCTCGAGGATATAGACCATCAACATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196309    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004612.2-5651s1c1
Sequence:CCGGGCAGGATTCTTTAGGCTTTATCTCGAGATAAAGCCTAAAGAATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004612
VALIDATED
TGFBR1 MISSION shRNA shRNA Plasmid DNA
transforming growth factor, beta receptor 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004612.1-1463s1c1
Sequence:CCGGGCCTTGAGAGTAATGGCTAAACTCGAGTTTAGCCATTACTCTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004612.1-1157s1c1
Sequence:CCGGGCCACAGATACCATTGATATTCTCGAGAATATCAATGGTATCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004612.1-1316s1c1
Sequence:CCGGCGATGTTCCATTGGTGGAATTCTCGAGAATTCCACCAATGGAACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004612.1-680s1c1
Sequence:CCGGGCGAGAACTATTGTGTTACAACTCGAGTTGTAACACAATAGTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039773    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004612.1-1871s1c1
Sequence:CCGGGCTGGTCTTAACTTTAGGTAACTCGAGTTACCTAAAGTTAAGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004612.x-1493s1c1
Sequence:CCGGAATGTTGGTATGCCAATGGACTCGAGTCCATTGGCATACCAACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004612.x-2229s1c1
Sequence:CCGGCAGTAAGTGCCACTTCTGTGTCTCGAGACACAGAAGTGGCACTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004612.x-275s1c1
Sequence:CCGGCACAACAGCATGTGTATAGCTCTCGAGAGCTATACACATGCTGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196326    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004612.2-4094s1c1
Sequence:CCGGGATCATGATTACTGTCGATAACTCGAGTTATCGACAGTAATCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004612.2-758s1c1
Sequence:CCGGGAAGTTGCTGTTAAGATATTCCTCGAGGAATATCTTAACAGCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004612.2-565s1c1
Sequence:CCGGCCCTTCATTAGATCGCCCTTTCTCGAGAAAGGGCGATCTAATGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004612.2-410s1c1
Sequence:CCGGCCAACTACTGTAAAGTCATCACTCGAGTGATGACTTTACAGTAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004612.2-497s1c1
Sequence:CCGGCTCATGTTGATGGTCTATATCCTCGAGGATATAGACCATCAACATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196309    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004612.2-5651s1c1
Sequence:CCGGGCAGGATTCTTTAGGCTTTATCTCGAGATAAAGCCTAAAGAATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004612
VALIDATED
TGFBR1 MISSION shRNA Lentiviral Transduction Particles
transforming growth factor, beta receptor 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004612.1-1463s1c1
Sequence:CCGGGCCTTGAGAGTAATGGCTAAACTCGAGTTTAGCCATTACTCTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004612.1-1157s1c1
Sequence:CCGGGCCACAGATACCATTGATATTCTCGAGAATATCAATGGTATCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004612.1-1316s1c1
Sequence:CCGGCGATGTTCCATTGGTGGAATTCTCGAGAATTCCACCAATGGAACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004612.1-680s1c1
Sequence:CCGGGCGAGAACTATTGTGTTACAACTCGAGTTGTAACACAATAGTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039773    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004612.1-1871s1c1
Sequence:CCGGGCTGGTCTTAACTTTAGGTAACTCGAGTTACCTAAAGTTAAGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004612.x-1493s1c1
Sequence:CCGGAATGTTGGTATGCCAATGGACTCGAGTCCATTGGCATACCAACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004612.x-2229s1c1
Sequence:CCGGCAGTAAGTGCCACTTCTGTGTCTCGAGACACAGAAGTGGCACTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004612.x-275s1c1
Sequence:CCGGCACAACAGCATGTGTATAGCTCTCGAGAGCTATACACATGCTGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196326    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004612.2-4094s1c1
Sequence:CCGGGATCATGATTACTGTCGATAACTCGAGTTATCGACAGTAATCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004612.2-758s1c1
Sequence:CCGGGAAGTTGCTGTTAAGATATTCCTCGAGGAATATCTTAACAGCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004612.2-565s1c1
Sequence:CCGGCCCTTCATTAGATCGCCCTTTCTCGAGAAAGGGCGATCTAATGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004612.2-410s1c1
Sequence:CCGGCCAACTACTGTAAAGTCATCACTCGAGTGATGACTTTACAGTAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004612.2-497s1c1
Sequence:CCGGCTCATGTTGATGGTCTATATCCTCGAGGATATAGACCATCAACATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196309    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004612.2-5651s1c1
Sequence:CCGGGCAGGATTCTTTAGGCTTTATCTCGAGATAAAGCCTAAAGAATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks