EMAIL THIS PAGE TO A FRIEND

TGFBR2

transforming growth factor, beta receptor II (70/80kDa)

Synonyms: AAT3 FAA3 LDS1B LDS2B MFS2 RIIC TAAD2 TGFR-2 TGFbeta-RII
UniProtKB ID: P37173, B4DTV5, Q15580, Q6DKT6, Q99474
Gene ID:
Human(7048) Summary: This gene encodes a member of the Ser/Thr protein kinase family and the TGFB receptor subfamily. The encoded protein is a transmembrane protein that has a protein kinase domain, forms a heterodimeric complex with another receptor protein, and binds TGF-beta. This receptor/ligand complex phosphorylates proteins, which then enter the nucleus and regulate the transcription of a subset of genes related to cell proliferation. Mutations in this gene have been associated with Marfan Syndrome, Loeys-Deitz Aortic Aneurysm Syndrome, and the development of various types of tumors. Alternatively spliced transcript variants encoding different isoforms have been characterized. [provided by RefSeq, Jul 2008]
Mouse(21813) transforming growth factor, beta receptor II
Rat(81810) transforming growth factor, beta receptor II
Zebrafish(30739) transforming growth factor, beta receptor II
Horse(100033860) transforming growth factor, beta receptor II (70/80kDa)
domestic cat(101091725) transforming growth factor, beta receptor II (70/80kDa)
dog(477039) transforming growth factor, beta receptor II (70/80kDa)
chicken(396399) transforming growth factor, beta receptor II (70/80kDa)
domestic guinea pig(100718284) transforming growth factor, beta receptor II (70/80kDa)
naked mole-rat(101704397) transforming growth factor, beta receptor II (70/80kDa)
cow(535376) transforming growth factor, beta receptor II (70/80kDa)
sheep(494191) transforming growth factor, beta receptor II (70/80kDa)
198 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003242 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003242 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003242 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009371 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009371 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009371 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU020151 MISSION® esiRNA esiRNA targeting mouse Tgfbr2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024847 Rosetta Predictions human pricing
NM_003242 Rosetta Predictions human pricing
NM_031132 Rosetta Predictions rat pricing
NM_009371 Rosetta Predictions mouse pricing
NM_029575 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024847 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099216 predicted 1816
2 SASI_Hs01_00099218 predicted 1617
3 SASI_Hs01_00099219 predicted 2134
4 SASI_Hs01_00099220 predicted 1742
5 SASI_Hs01_00099221 predicted 1830
6 SASI_Hs02_00307253 predicted 1600
7 SASI_Hs01_00099222 predicted 1278
8 SASI_Hs01_00099223 predicted 1224
9 SASI_Hs01_00099225 predicted 1907
10 SASI_Hs02_00307254 predicted 1561
11 SASI_Hs01_00099217 predicted 1838
12 SASI_Hs01_00099224 predicted 1111
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003242 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095378 predicted 1743
2 SASI_Hs01_00095380 predicted 1548
3 SASI_Hs01_00095381 predicted 2060
4 SASI_Hs01_00095382 predicted 1664
5 SASI_Hs01_00095383 predicted 1761
6 SASI_Hs02_00335280 predicted 1528
7 SASI_Hs01_00095384 predicted 1204
8 SASI_Hs01_00095385 predicted 1153
9 SASI_Hs01_00095387 predicted 1831
10 SASI_Hs02_00335281 predicted 1491
11 SASI_Hs01_00095379 predicted 1760
12 SASI_Hs01_00095386 predicted 1031
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031132 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264457 predicted 670
2 SASI_Rn01_00067811 predicted 1093
3 SASI_Rn01_00067812 predicted 1409
4 SASI_Rn01_00067813 predicted 1535
5 SASI_Rn01_00067814 predicted 1360
6 SASI_Rn01_00067815 predicted 1403
7 SASI_Rn02_00264458 predicted 434
8 SASI_Rn01_00067816 predicted 1600
9 SASI_Rn01_00067818 predicted 344
10 SASI_Rn01_00067819 predicted 1253
11 SASI_Rn01_00067817 predicted 800
12 SASI_Rn01_00067820 predicted 1027
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009371 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114852 predicted 1417
2 SASI_Mm01_00114853 predicted 1699
3 SASI_Mm01_00114854 predicted 1641
4 SASI_Mm01_00114855 predicted 1610
5 SASI_Mm01_00114856 predicted 1490
6 SASI_Mm01_00114857 predicted 1688
7 SASI_Mm01_00114858 predicted 1432
8 SASI_Mm01_00114859 predicted 1471
9 SASI_Mm02_00315977 predicted 1577
10 SASI_Mm01_00114861 predicted 1494
11 SASI_Mm01_00114860 predicted 1783
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029575 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125669 predicted 1094
2 SASI_Mm01_00125670 predicted 1378
3 SASI_Mm01_00125671 predicted 1313
4 SASI_Mm01_00125672 predicted 1275
5 SASI_Mm01_00125673 predicted 1164
6 SASI_Mm01_00125674 predicted 1361
7 SASI_Mm01_00125675 predicted 1108
8 SASI_Mm01_00125676 predicted 1139
9 SASI_Mm02_00335524 predicted 1250
10 SASI_Mm01_00125678 predicted 1169
11 SASI_Mm01_00125677 predicted 1458
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003242
VALIDATED
TGFBR2 MISSION shRNA Bacterial Glycerol Stock
transforming growth factor, beta receptor II (70/80kDa)
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.4-1517s1c1
Sequence:CCGGGACCTCAAGAGCTCCAATATCCTCGAGGATATTGGAGCTCTTGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197031    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.4-3521s1c1
Sequence:CCGGGCAGTCATTCTCTGGGTATATCTCGAGATATACCCAGAGAATGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194992    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.4-3061s1c1
Sequence:CCGGCTCTAGGCTTTATCGTGTTTACTCGAGTAAACACGATAAAGCCTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.4-2859s1c1
Sequence:CCGGCCATCTTTAATACCTTGAATGCTCGAGCATTCAAGGTATTAAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.4-484s1c1
Sequence:CCGGCGACATGATAGTCACTGACAACTCGAGTTGTCAGTGACTATCATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003242.4-731s1c1
Sequence:CCGGGCTTCTCCAAAGTGCATTATGCTCGAGCATAATGCACTTTGGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.x-1842s1c1
Sequence:CCGGAATGACGAGAACATAACACTCTCGAGAGTGTTATGTTCTCGTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003242.x-2017s1c1
Sequence:CCGGGCTCCCTAAACACTACCAAATCTCGAGATTTGGTAGTGTTTAGGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010446    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.x-2421s1c1
Sequence:CCGGAGTATGCCTCTTGGAAGACACTCGAGTGTCTTCCAAGAGGCATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.x-890s1c1
Sequence:CCGGCTTCTACTGCTACCGCGTTAACTCGAGTTAACGCGGTAGCAGTAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.x-786s1c1
Sequence:CCGGGAAGAATATAACACCAGCAATCTCGAGATTGCTGGTGTTATATTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.3-807s1c1
Sequence:CCGGCCTGACTTGTTGCTAGTCATACTCGAGTATGACTAGCAACAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.3-1127s1c1
Sequence:CCGGGCAGAACACTTCAGAGCAGTTCTCGAGAACTGCTCTGAAGTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.3-719s1c1
Sequence:CCGGGCCTGGTGAGACTTTCTTCATCTCGAGATGAAGAAAGTCTCACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.3-416s1c1
Sequence:CCGGCGTTCAGAAGTCGGTTAATAACTCGAGTTATTAACCGACTTCTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.3-1599s1c1
Sequence:CCGGGCAAGATACATGGCTCCAGAACTCGAGTTCTGGAGCCATGTATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003242
VALIDATED
TGFBR2 MISSION shRNA shRNA Plasmid DNA
transforming growth factor, beta receptor II (70/80kDa)
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.4-1517s1c1
Sequence:CCGGGACCTCAAGAGCTCCAATATCCTCGAGGATATTGGAGCTCTTGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197031    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.4-3521s1c1
Sequence:CCGGGCAGTCATTCTCTGGGTATATCTCGAGATATACCCAGAGAATGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194992    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.4-3061s1c1
Sequence:CCGGCTCTAGGCTTTATCGTGTTTACTCGAGTAAACACGATAAAGCCTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.4-2859s1c1
Sequence:CCGGCCATCTTTAATACCTTGAATGCTCGAGCATTCAAGGTATTAAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.4-484s1c1
Sequence:CCGGCGACATGATAGTCACTGACAACTCGAGTTGTCAGTGACTATCATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003242.4-731s1c1
Sequence:CCGGGCTTCTCCAAAGTGCATTATGCTCGAGCATAATGCACTTTGGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.x-1842s1c1
Sequence:CCGGAATGACGAGAACATAACACTCTCGAGAGTGTTATGTTCTCGTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003242.x-2017s1c1
Sequence:CCGGGCTCCCTAAACACTACCAAATCTCGAGATTTGGTAGTGTTTAGGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010446    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.x-2421s1c1
Sequence:CCGGAGTATGCCTCTTGGAAGACACTCGAGTGTCTTCCAAGAGGCATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.x-890s1c1
Sequence:CCGGCTTCTACTGCTACCGCGTTAACTCGAGTTAACGCGGTAGCAGTAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.x-786s1c1
Sequence:CCGGGAAGAATATAACACCAGCAATCTCGAGATTGCTGGTGTTATATTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.3-807s1c1
Sequence:CCGGCCTGACTTGTTGCTAGTCATACTCGAGTATGACTAGCAACAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.3-1127s1c1
Sequence:CCGGGCAGAACACTTCAGAGCAGTTCTCGAGAACTGCTCTGAAGTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.3-719s1c1
Sequence:CCGGGCCTGGTGAGACTTTCTTCATCTCGAGATGAAGAAAGTCTCACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.3-416s1c1
Sequence:CCGGCGTTCAGAAGTCGGTTAATAACTCGAGTTATTAACCGACTTCTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.3-1599s1c1
Sequence:CCGGGCAAGATACATGGCTCCAGAACTCGAGTTCTGGAGCCATGTATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003242
VALIDATED
TGFBR2 MISSION shRNA Lentiviral Transduction Particles
transforming growth factor, beta receptor II (70/80kDa)
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.4-1517s1c1
Sequence:CCGGGACCTCAAGAGCTCCAATATCCTCGAGGATATTGGAGCTCTTGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197031    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.4-3521s1c1
Sequence:CCGGGCAGTCATTCTCTGGGTATATCTCGAGATATACCCAGAGAATGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194992    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.4-3061s1c1
Sequence:CCGGCTCTAGGCTTTATCGTGTTTACTCGAGTAAACACGATAAAGCCTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.4-2859s1c1
Sequence:CCGGCCATCTTTAATACCTTGAATGCTCGAGCATTCAAGGTATTAAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.4-484s1c1
Sequence:CCGGCGACATGATAGTCACTGACAACTCGAGTTGTCAGTGACTATCATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003242.4-731s1c1
Sequence:CCGGGCTTCTCCAAAGTGCATTATGCTCGAGCATAATGCACTTTGGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.x-1842s1c1
Sequence:CCGGAATGACGAGAACATAACACTCTCGAGAGTGTTATGTTCTCGTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003242.x-2017s1c1
Sequence:CCGGGCTCCCTAAACACTACCAAATCTCGAGATTTGGTAGTGTTTAGGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010446    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.x-2421s1c1
Sequence:CCGGAGTATGCCTCTTGGAAGACACTCGAGTGTCTTCCAAGAGGCATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.x-890s1c1
Sequence:CCGGCTTCTACTGCTACCGCGTTAACTCGAGTTAACGCGGTAGCAGTAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.x-786s1c1
Sequence:CCGGGAAGAATATAACACCAGCAATCTCGAGATTGCTGGTGTTATATTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.3-807s1c1
Sequence:CCGGCCTGACTTGTTGCTAGTCATACTCGAGTATGACTAGCAACAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.3-1127s1c1
Sequence:CCGGGCAGAACACTTCAGAGCAGTTCTCGAGAACTGCTCTGAAGTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.3-719s1c1
Sequence:CCGGGCCTGGTGAGACTTTCTTCATCTCGAGATGAAGAAAGTCTCACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.3-416s1c1
Sequence:CCGGCGTTCAGAAGTCGGTTAATAACTCGAGTTATTAACCGACTTCTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003242.3-1599s1c1
Sequence:CCGGGCAAGATACATGGCTCCAGAACTCGAGTTCTGGAGCCATGTATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009371
VALIDATED
TGFBR2 MISSION shRNA Bacterial Glycerol Stock
transforming growth factor, beta receptor II (70/80kDa)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009371.2-801s1c1
Sequence:CCGGCGACCTGTTGTTGGTCATTATCTCGAGATAATGACCAACAACAGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009371.2-377s1c1
Sequence:CCGGCCATCCACGTAAGCTGTAATACTCGAGTATTACAGCTTACGTGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009371.2-2009s1c1
Sequence:CCGGGCTCGCTGAACACTACCAAATCTCGAGATTTGGTAGTGTTCAGCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009371.2-1857s1c1
Sequence:CCGGCCAGATCGTGTGTGAGACTTTCTCGAGAAAGTCTCACACACGATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009371.2-401s1c1
Sequence:CCGGCCATCCATCCACTGAAACATTCTCGAGAATGTTTCAGTGGATGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009371.2-1197s21c1
Sequence:CCGGGAAGGACATCTTCTCCGATATCTCGAGATATCGGAGAAGATGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009371.2-744s21c1
Sequence:CCGGCATGGAAGAGTGCAACGATTACTCGAGTAATCGTTGCACTCTTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009371.2-431s21c1
Sequence:CCGGATGTCATGGCCAGCGACAATGCTCGAGCATTGTCGCTGGCCATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009371.2-1857s21c1
Sequence:CCGGCCAGATCGTGTGTGAGACTTTCTCGAGAAAGTCTCACACACGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009371.2-2287s21c1
Sequence:CCGGCTCAGGAAATGAGATTGATTTCTCGAGAAATCAATCTCATTTCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009371
VALIDATED
TGFBR2 MISSION shRNA shRNA Plasmid DNA
transforming growth factor, beta receptor II (70/80kDa)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009371.2-801s1c1
Sequence:CCGGCGACCTGTTGTTGGTCATTATCTCGAGATAATGACCAACAACAGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009371.2-377s1c1
Sequence:CCGGCCATCCACGTAAGCTGTAATACTCGAGTATTACAGCTTACGTGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009371.2-2009s1c1
Sequence:CCGGGCTCGCTGAACACTACCAAATCTCGAGATTTGGTAGTGTTCAGCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009371.2-1857s1c1
Sequence:CCGGCCAGATCGTGTGTGAGACTTTCTCGAGAAAGTCTCACACACGATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009371.2-401s1c1
Sequence:CCGGCCATCCATCCACTGAAACATTCTCGAGAATGTTTCAGTGGATGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009371.2-1197s21c1
Sequence:CCGGGAAGGACATCTTCTCCGATATCTCGAGATATCGGAGAAGATGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009371.2-744s21c1
Sequence:CCGGCATGGAAGAGTGCAACGATTACTCGAGTAATCGTTGCACTCTTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009371.2-431s21c1
Sequence:CCGGATGTCATGGCCAGCGACAATGCTCGAGCATTGTCGCTGGCCATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009371.2-1857s21c1
Sequence:CCGGCCAGATCGTGTGTGAGACTTTCTCGAGAAAGTCTCACACACGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009371.2-2287s21c1
Sequence:CCGGCTCAGGAAATGAGATTGATTTCTCGAGAAATCAATCTCATTTCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009371
VALIDATED
TGFBR2 MISSION shRNA Lentiviral Transduction Particles
transforming growth factor, beta receptor II (70/80kDa)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009371.2-801s1c1
Sequence:CCGGCGACCTGTTGTTGGTCATTATCTCGAGATAATGACCAACAACAGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009371.2-377s1c1
Sequence:CCGGCCATCCACGTAAGCTGTAATACTCGAGTATTACAGCTTACGTGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009371.2-2009s1c1
Sequence:CCGGGCTCGCTGAACACTACCAAATCTCGAGATTTGGTAGTGTTCAGCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009371.2-1857s1c1
Sequence:CCGGCCAGATCGTGTGTGAGACTTTCTCGAGAAAGTCTCACACACGATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009371.2-401s1c1
Sequence:CCGGCCATCCATCCACTGAAACATTCTCGAGAATGTTTCAGTGGATGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009371.2-1197s21c1
Sequence:CCGGGAAGGACATCTTCTCCGATATCTCGAGATATCGGAGAAGATGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009371.2-744s21c1
Sequence:CCGGCATGGAAGAGTGCAACGATTACTCGAGTAATCGTTGCACTCTTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009371.2-431s21c1
Sequence:CCGGATGTCATGGCCAGCGACAATGCTCGAGCATTGTCGCTGGCCATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009371.2-1857s21c1
Sequence:CCGGCCAGATCGTGTGTGAGACTTTCTCGAGAAAGTCTCACACACGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009371.2-2287s21c1
Sequence:CCGGCTCAGGAAATGAGATTGATTTCTCGAGAAATCAATCTCATTTCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks