EMAIL THIS PAGE TO A FRIEND

TGFBR3

transforming growth factor, beta receptor III

Synonyms: BGCAN betaglycan
Gene ID:
Human(7049) Summary: This locus encodes the transforming growth factor (TGF)-beta type III receptor. The encoded receptor is a membrane proteoglycan that often functions as a co-receptor with other TGF-beta receptor superfamily members. Ectodomain shedding produces soluble TGFBR3, which may inhibit TGFB signaling. Decreased expression of this receptor has been observed in various cancers. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene.[provided by RefSeq, Sep 2010]
Mouse(21814) transforming growth factor, beta receptor III
Rat(29610) transforming growth factor, beta receptor III
cow(784894) transforming growth factor, beta receptor III
sheep(101102437) transforming growth factor, beta receptor III
naked mole-rat(101720371) transforming growth factor, beta receptor III
domestic guinea pig(100719092) transforming growth factor, beta receptor III
Zebrafish(100332594) transforming growth factor, beta receptor III
dog(490163) transforming growth factor, beta receptor III
chicken(374251) transforming growth factor, beta receptor III
domestic cat(101096404) transforming growth factor, beta receptor III
95 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0738 Human TGFBR3 ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003243 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003243 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003243 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011578 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011578 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011578 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003243 Rosetta Predictions human pricing
NM_017256 Rosetta Predictions rat pricing
NM_011578 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003243 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099731 predicted 1330
2 SASI_Hs01_00099732 predicted 1165
3 SASI_Hs01_00099733 predicted 1709
4 SASI_Hs01_00099734 predicted 1430
5 SASI_Hs01_00099735 predicted 2264
6 SASI_Hs02_00335282 predicted 2178
7 SASI_Hs01_00099736 predicted 2311
8 SASI_Hs01_00099737 predicted 1359
9 SASI_Hs01_00099738 predicted 1673
10 SASI_Hs01_00099739 predicted 1798
11 SASI_Hs01_00099740 predicted 920
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017256 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107645 predicted 1883
2 SASI_Rn02_00261647 predicted 2169
3 SASI_Rn01_00107647 predicted 852
4 SASI_Rn01_00107648 predicted 2116
5 SASI_Rn01_00107649 predicted 873
6 SASI_Rn01_00107650 predicted 1275
7 SASI_Rn01_00107652 predicted 1033
8 SASI_Rn01_00107653 predicted 1172
9 SASI_Rn01_00107654 predicted 584
10 SASI_Rn02_00261648 predicted 1613
11 SASI_Rn01_00107646 predicted 1038
12 SASI_Rn01_00107651 predicted 635
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011578 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109012 predicted 2565
2 SASI_Mm01_00109013 predicted 891
3 SASI_Mm01_00109015 predicted 2132
4 SASI_Mm02_00320970 predicted 1271
5 SASI_Mm01_00109016 predicted 1816
6 SASI_Mm01_00109017 predicted 2400
7 SASI_Mm01_00109018 predicted 1701
8 SASI_Mm01_00109019 predicted 2509
9 SASI_Mm01_00109020 predicted 1050
10 SASI_Mm01_00109021 predicted 600
11 SASI_Mm01_00109014 predicted 2266
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003243
TGFBR3 MISSION shRNA Bacterial Glycerol Stock
transforming growth factor, beta receptor III
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003243.3-3396s21c1
Sequence:CCGGGGAGTTGGTAAAGGGTTAATACTCGAGTATTAACCCTTTACCAACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003243.3-3192s21c1
Sequence:CCGGCACACCCAGGGCTAGTATAAACTCGAGTTTATACTAGCCCTGGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003243.3-2107s21c1
Sequence:CCGGTAATGGATTTCCGGGAGATATCTCGAGATATCTCCCGGAAATCCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003243.1-2255s1c1
Sequence:CCGGCGTGCTTTATCTCTCCATATTCTCGAGAATATGGAGAGATAAAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003243.1-2032s1c1
Sequence:CCGGCGACCTGAAATCGTGGTGTTTCTCGAGAAACACCACGATTTCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003243.1-870s1c1
Sequence:CCGGCGAACTCAAGATAGCAAGAAACTCGAGTTTCTTGCTATCTTGAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003243.1-2638s1c1
Sequence:CCGGCCAAGCATGAAGGAACCAAATCTCGAGATTTGGTTCCTTCATGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003243.1-2181s1c1
Sequence:CCGGGCCAGAGAATGGACACGTTTACTCGAGTAAACGTGTCCATTCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003243
TGFBR3 MISSION shRNA shRNA Plasmid DNA
transforming growth factor, beta receptor III
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003243.3-3396s21c1
Sequence:CCGGGGAGTTGGTAAAGGGTTAATACTCGAGTATTAACCCTTTACCAACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003243.3-3192s21c1
Sequence:CCGGCACACCCAGGGCTAGTATAAACTCGAGTTTATACTAGCCCTGGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003243.3-2107s21c1
Sequence:CCGGTAATGGATTTCCGGGAGATATCTCGAGATATCTCCCGGAAATCCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003243.1-2255s1c1
Sequence:CCGGCGTGCTTTATCTCTCCATATTCTCGAGAATATGGAGAGATAAAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003243.1-2032s1c1
Sequence:CCGGCGACCTGAAATCGTGGTGTTTCTCGAGAAACACCACGATTTCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003243.1-870s1c1
Sequence:CCGGCGAACTCAAGATAGCAAGAAACTCGAGTTTCTTGCTATCTTGAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003243.1-2638s1c1
Sequence:CCGGCCAAGCATGAAGGAACCAAATCTCGAGATTTGGTTCCTTCATGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003243.1-2181s1c1
Sequence:CCGGGCCAGAGAATGGACACGTTTACTCGAGTAAACGTGTCCATTCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003243
TGFBR3 MISSION shRNA Lentiviral Transduction Particles
transforming growth factor, beta receptor III
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003243.3-3396s21c1
Sequence:CCGGGGAGTTGGTAAAGGGTTAATACTCGAGTATTAACCCTTTACCAACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003243.3-3192s21c1
Sequence:CCGGCACACCCAGGGCTAGTATAAACTCGAGTTTATACTAGCCCTGGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003243.3-2107s21c1
Sequence:CCGGTAATGGATTTCCGGGAGATATCTCGAGATATCTCCCGGAAATCCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003243.1-2255s1c1
Sequence:CCGGCGTGCTTTATCTCTCCATATTCTCGAGAATATGGAGAGATAAAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003243.1-2032s1c1
Sequence:CCGGCGACCTGAAATCGTGGTGTTTCTCGAGAAACACCACGATTTCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003243.1-870s1c1
Sequence:CCGGCGAACTCAAGATAGCAAGAAACTCGAGTTTCTTGCTATCTTGAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003243.1-2638s1c1
Sequence:CCGGCCAAGCATGAAGGAACCAAATCTCGAGATTTGGTTCCTTCATGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003243.1-2181s1c1
Sequence:CCGGGCCAGAGAATGGACACGTTTACTCGAGTAAACGTGTCCATTCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011578
VALIDATED
TGFBR3 MISSION shRNA Bacterial Glycerol Stock
transforming growth factor, beta receptor III
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011578.3-2051s21c1
Sequence:CCGGAGATTTGGAGTCGGGTGATAACTCGAGTTATCACCCGACTCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011578.3-1977s21c1
Sequence:CCGGGTGGTTTACTATAACTCTATTCTCGAGAATAGAGTTATAGTAAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348378    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011578.3-3152s21c1
Sequence:CCGGCTTACCACGGCCCACGTAAATCTCGAGATTTACGTGGGCCGTGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011578.3-2268s21c1
Sequence:CCGGGCAGAGAATGAGCATGTATATCTCGAGATATACATGCTCATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011578.3-1174s21c1
Sequence:CCGGGCACCTTCCAGGTGGATATAACTCGAGTTATATCCACCTGGAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011578.2-3020s1c1
Sequence:CCGGCCCTGTAAAGAGAGAGTGAATCTCGAGATTCACTCTCTCTTTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011578.2-945s1c1
Sequence:CCGGCCCACGTGTAACATAGGGAAACTCGAGTTTCCCTATGTTACACGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011578.2-2141s1c1
Sequence:CCGGGCTGTATAACACAGACCTCTTCTCGAGAAGAGGTCTGTGTTATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011578.2-1424s1c1
Sequence:CCGGGCTTGAGAACAACGAGGAGATCTCGAGATCTCCTCGTTGTTCTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011578.2-2193s1c1
Sequence:CCGGGCAGAGAATGAGCATGTATATCTCGAGATATACATGCTCATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011578
VALIDATED
TGFBR3 MISSION shRNA shRNA Plasmid DNA
transforming growth factor, beta receptor III
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011578.3-2051s21c1
Sequence:CCGGAGATTTGGAGTCGGGTGATAACTCGAGTTATCACCCGACTCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011578.3-1977s21c1
Sequence:CCGGGTGGTTTACTATAACTCTATTCTCGAGAATAGAGTTATAGTAAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348378    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011578.3-3152s21c1
Sequence:CCGGCTTACCACGGCCCACGTAAATCTCGAGATTTACGTGGGCCGTGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011578.3-2268s21c1
Sequence:CCGGGCAGAGAATGAGCATGTATATCTCGAGATATACATGCTCATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011578.3-1174s21c1
Sequence:CCGGGCACCTTCCAGGTGGATATAACTCGAGTTATATCCACCTGGAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011578.2-3020s1c1
Sequence:CCGGCCCTGTAAAGAGAGAGTGAATCTCGAGATTCACTCTCTCTTTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011578.2-945s1c1
Sequence:CCGGCCCACGTGTAACATAGGGAAACTCGAGTTTCCCTATGTTACACGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011578.2-2141s1c1
Sequence:CCGGGCTGTATAACACAGACCTCTTCTCGAGAAGAGGTCTGTGTTATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011578.2-1424s1c1
Sequence:CCGGGCTTGAGAACAACGAGGAGATCTCGAGATCTCCTCGTTGTTCTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011578.2-2193s1c1
Sequence:CCGGGCAGAGAATGAGCATGTATATCTCGAGATATACATGCTCATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011578
VALIDATED
TGFBR3 MISSION shRNA Lentiviral Transduction Particles
transforming growth factor, beta receptor III
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011578.3-2051s21c1
Sequence:CCGGAGATTTGGAGTCGGGTGATAACTCGAGTTATCACCCGACTCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011578.3-1977s21c1
Sequence:CCGGGTGGTTTACTATAACTCTATTCTCGAGAATAGAGTTATAGTAAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348378    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011578.3-3152s21c1
Sequence:CCGGCTTACCACGGCCCACGTAAATCTCGAGATTTACGTGGGCCGTGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011578.3-2268s21c1
Sequence:CCGGGCAGAGAATGAGCATGTATATCTCGAGATATACATGCTCATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011578.3-1174s21c1
Sequence:CCGGGCACCTTCCAGGTGGATATAACTCGAGTTATATCCACCTGGAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011578.2-3020s1c1
Sequence:CCGGCCCTGTAAAGAGAGAGTGAATCTCGAGATTCACTCTCTCTTTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011578.2-945s1c1
Sequence:CCGGCCCACGTGTAACATAGGGAAACTCGAGTTTCCCTATGTTACACGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011578.2-2141s1c1
Sequence:CCGGGCTGTATAACACAGACCTCTTCTCGAGAAGAGGTCTGTGTTATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011578.2-1424s1c1
Sequence:CCGGGCTTGAGAACAACGAGGAGATCTCGAGATCTCCTCGTTGTTCTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011578.2-2193s1c1
Sequence:CCGGGCAGAGAATGAGCATGTATATCTCGAGATATACATGCTCATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks