EMAIL THIS PAGE TO A FRIEND

TGFBRAP1

transforming growth factor, beta receptor associated protein 1

Synonyms: TRAP-1 TRAP1
UniProtKB ID: Q8WUH2, A8K5R7, D3DVJ8, O60466
Gene ID:
Mouse(73122) transforming growth factor, beta receptor associated protein 1
Rat(301373) transforming growth factor, beta receptor associated protein 1
cow(514660) transforming growth factor, beta receptor associated protein 1
sheep(101123361) transforming growth factor, beta receptor associated protein 1
naked mole-rat(101717957) transforming growth factor, beta receptor associated protein 1
Domestic Rabbit(100355109) transforming growth factor, beta receptor associated protein 1
domestic guinea pig(100731938) transforming growth factor, beta receptor associated protein 1
Zebrafish(565026) transforming growth factor, beta receptor associated protein 1
chicken(418724) transforming growth factor, beta receptor associated protein 1
Horse(100055793) transforming growth factor, beta receptor associated protein 1
domestic cat(101100633) transforming growth factor, beta receptor associated protein 1
dog(481320) transforming growth factor, beta receptor associated protein 1
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_129857 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_129857 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_129857 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004257 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004257 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004257 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004257 Rosetta Predictions human pricing
NM_001106907 Rosetta Predictions rat pricing
NM_001013025 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004257 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337204 predicted 1668
2 SASI_Hs01_00196016 predicted 1032
3 SASI_Hs01_00196017 predicted 1464
4 SASI_Hs01_00196018 predicted 1576
5 SASI_Hs01_00196019 predicted 1787
6 SASI_Hs01_00196021 predicted 903
7 SASI_Hs01_00196022 predicted 917
8 SASI_Hs01_00196023 predicted 276
9 SASI_Hs02_00337205 predicted 273
10 SASI_Hs01_00196024 predicted 1748
11 SASI_Hs01_00196020 predicted 1108
12 SASI_Hs01_00196025 predicted 1826
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106907 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223576 predicted 1404
2 SASI_Rn02_00223577 predicted 1501
3 SASI_Rn02_00223578 predicted 901
4 SASI_Rn02_00223579 predicted 916
5 SASI_Rn02_00223580 predicted 742
6 SASI_Rn02_00223581 predicted 1581
7 SASI_Rn02_00223582 predicted 2063
8 SASI_Rn02_00223583 predicted 989
9 SASI_Rn02_00223584 predicted 2038
10 SASI_Rn02_00223585 predicted 492
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013025 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200230 predicted 685
2 SASI_Mm01_00200232 predicted 1002
3 SASI_Mm01_00200233 predicted 3065
4 SASI_Mm01_00200234 predicted 2292
5 SASI_Mm01_00200235 predicted 1968
6 SASI_Mm01_00200236 predicted 2078
7 SASI_Mm02_00287148 predicted 1600
8 SASI_Mm01_00200238 predicted 2317
9 SASI_Mm01_00200239 predicted 1366
10 SASI_Mm02_00287149 predicted 912
11 SASI_Mm01_00200231 predicted 1435
12 SASI_Mm01_00200237 predicted 1401
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_129857
VALIDATED
TGFBRAP1 MISSION shRNA Bacterial Glycerol Stock
transforming growth factor, beta receptor associated protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129857.4-2340s1c1
Sequence:CCGGTGAACCATCATGCCAGGGAATCTCGAGATTCCCTGGCATGATGGTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129857.4-2075s1c1
Sequence:CCGGGTCCACTTGTTGAAAGAGAAACTCGAGTTTCTCTTTCAACAAGTGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129857.4-551s1c1
Sequence:CCGGCGCAGGACTGTCCAAATGTTTCTCGAGAAACATTTGGACAGTCCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129857.4-1002s1c1
Sequence:CCGGGAAGAGTGATTGTTGCCACAACTCGAGTTGTGGCAACAATCACTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129857.4-406s1c1
Sequence:CCGGCAACTCTATAACCCTGGTTAACTCGAGTTAACCAGGGTTATAGAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_129857
VALIDATED
TGFBRAP1 MISSION shRNA shRNA Plasmid DNA
transforming growth factor, beta receptor associated protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129857.4-2340s1c1
Sequence:CCGGTGAACCATCATGCCAGGGAATCTCGAGATTCCCTGGCATGATGGTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129857.4-2075s1c1
Sequence:CCGGGTCCACTTGTTGAAAGAGAAACTCGAGTTTCTCTTTCAACAAGTGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129857.4-551s1c1
Sequence:CCGGCGCAGGACTGTCCAAATGTTTCTCGAGAAACATTTGGACAGTCCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129857.4-1002s1c1
Sequence:CCGGGAAGAGTGATTGTTGCCACAACTCGAGTTGTGGCAACAATCACTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129857.4-406s1c1
Sequence:CCGGCAACTCTATAACCCTGGTTAACTCGAGTTAACCAGGGTTATAGAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_129857
VALIDATED
TGFBRAP1 MISSION shRNA Lentiviral Transduction Particles
transforming growth factor, beta receptor associated protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129857.4-2340s1c1
Sequence:CCGGTGAACCATCATGCCAGGGAATCTCGAGATTCCCTGGCATGATGGTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129857.4-2075s1c1
Sequence:CCGGGTCCACTTGTTGAAAGAGAAACTCGAGTTTCTCTTTCAACAAGTGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129857.4-551s1c1
Sequence:CCGGCGCAGGACTGTCCAAATGTTTCTCGAGAAACATTTGGACAGTCCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129857.4-1002s1c1
Sequence:CCGGGAAGAGTGATTGTTGCCACAACTCGAGTTGTGGCAACAATCACTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129857.4-406s1c1
Sequence:CCGGCAACTCTATAACCCTGGTTAACTCGAGTTAACCAGGGTTATAGAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004257
VALIDATED
TGFBRAP1 MISSION shRNA Bacterial Glycerol Stock
transforming growth factor, beta receptor associated protein 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004257.3-1830s1c1
Sequence:CCGGGCCCTTGTGAAGTATCTGGAACTCGAGTTCCAGATACTTCACAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004257.3-1074s1c1
Sequence:CCGGCGGAGGAACATTCCAAAGGAACTCGAGTTCCTTTGGAATGTTCCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004257.3-2462s1c1
Sequence:CCGGCTACGATAAGATGAAGTTGAACTCGAGTTCAACTTCATCTTATCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005761    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_004257.3-2680s1c1
Sequence:CCGGCGAGTTCTTTCTGAGCCTGCTCTCGAGAGCAGGCTCAGAAAGAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004257.3-1997s1c1
Sequence:CCGGGCTCCAGAAATCTGATTTATACTCGAGTATAAATCAGATTTCTGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004257.4-1390s21c1
Sequence:CCGGCGCAGCACAGAGGTAGCAAATCTCGAGATTTGCTACCTCTGTGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004257.4-1140s21c1
Sequence:CCGGTCTGCAGCAGGCGGGATTTATCTCGAGATAAATCCCGCCTGCTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004257.4-2794s21c1
Sequence:CCGGTTCCGTCCATACGCAACAAGGCTCGAGCCTTGTTGCGTATGGACGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004257.4-1557s21c1
Sequence:CCGGACTTGGACTGCTCTATCATTACTCGAGTAATGATAGAGCAGTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004257.4-2118s21c1
Sequence:CCGGGCATGAGAAGGCGCTGCATATCTCGAGATATGCAGCGCCTTCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004257.4-1659s21c1
Sequence:CCGGGTATGAATACATCGTGGATTTCTCGAGAAATCCACGATGTATTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004257
VALIDATED
TGFBRAP1 MISSION shRNA shRNA Plasmid DNA
transforming growth factor, beta receptor associated protein 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004257.3-1830s1c1
Sequence:CCGGGCCCTTGTGAAGTATCTGGAACTCGAGTTCCAGATACTTCACAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004257.3-1074s1c1
Sequence:CCGGCGGAGGAACATTCCAAAGGAACTCGAGTTCCTTTGGAATGTTCCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004257.3-2462s1c1
Sequence:CCGGCTACGATAAGATGAAGTTGAACTCGAGTTCAACTTCATCTTATCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005761    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_004257.3-2680s1c1
Sequence:CCGGCGAGTTCTTTCTGAGCCTGCTCTCGAGAGCAGGCTCAGAAAGAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004257.3-1997s1c1
Sequence:CCGGGCTCCAGAAATCTGATTTATACTCGAGTATAAATCAGATTTCTGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004257.4-1390s21c1
Sequence:CCGGCGCAGCACAGAGGTAGCAAATCTCGAGATTTGCTACCTCTGTGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004257.4-1140s21c1
Sequence:CCGGTCTGCAGCAGGCGGGATTTATCTCGAGATAAATCCCGCCTGCTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004257.4-2794s21c1
Sequence:CCGGTTCCGTCCATACGCAACAAGGCTCGAGCCTTGTTGCGTATGGACGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004257.4-1557s21c1
Sequence:CCGGACTTGGACTGCTCTATCATTACTCGAGTAATGATAGAGCAGTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004257.4-2118s21c1
Sequence:CCGGGCATGAGAAGGCGCTGCATATCTCGAGATATGCAGCGCCTTCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004257.4-1659s21c1
Sequence:CCGGGTATGAATACATCGTGGATTTCTCGAGAAATCCACGATGTATTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004257
VALIDATED
TGFBRAP1 MISSION shRNA Lentiviral Transduction Particles
transforming growth factor, beta receptor associated protein 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004257.3-1830s1c1
Sequence:CCGGGCCCTTGTGAAGTATCTGGAACTCGAGTTCCAGATACTTCACAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004257.3-1074s1c1
Sequence:CCGGCGGAGGAACATTCCAAAGGAACTCGAGTTCCTTTGGAATGTTCCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004257.3-2462s1c1
Sequence:CCGGCTACGATAAGATGAAGTTGAACTCGAGTTCAACTTCATCTTATCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005761    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_004257.3-2680s1c1
Sequence:CCGGCGAGTTCTTTCTGAGCCTGCTCTCGAGAGCAGGCTCAGAAAGAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004257.3-1997s1c1
Sequence:CCGGGCTCCAGAAATCTGATTTATACTCGAGTATAAATCAGATTTCTGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004257.4-1390s21c1
Sequence:CCGGCGCAGCACAGAGGTAGCAAATCTCGAGATTTGCTACCTCTGTGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004257.4-1140s21c1
Sequence:CCGGTCTGCAGCAGGCGGGATTTATCTCGAGATAAATCCCGCCTGCTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004257.4-2794s21c1
Sequence:CCGGTTCCGTCCATACGCAACAAGGCTCGAGCCTTGTTGCGTATGGACGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004257.4-1557s21c1
Sequence:CCGGACTTGGACTGCTCTATCATTACTCGAGTAATGATAGAGCAGTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004257.4-2118s21c1
Sequence:CCGGGCATGAGAAGGCGCTGCATATCTCGAGATATGCAGCGCCTTCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004257.4-1659s21c1
Sequence:CCGGGTATGAATACATCGTGGATTTCTCGAGAAATCCACGATGTATTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks