EMAIL THIS PAGE TO A FRIEND

TGIF1

TGFB-induced factor homeobox 1

Synonyms: HPE4 TGIF
Gene ID:
Human(7050) Summary: The protein encoded by this gene is a member of the three-amino acid loop extension (TALE) superclass of atypical homeodomains. TALE homeobox proteins are highly conserved transcription regulators. This particular homeodomain binds to a previously characterized retinoid X receptor responsive element from the cellular retinol-binding protein II promoter. In addition to its role in inhibiting 9-cis-retinoic acid-dependent RXR alpha transcription activation of the retinoic acid responsive element, the protein is an active transcriptional co-repressor of SMAD2 and may participate in the transmission of nuclear signals during development and in the adult. Mutations in this gene are associated with holoprosencephaly type 4, which is a structural anomaly of the brain. Alternative splicing has been observed at this locus and multiple splice variants encoding distinct isoforms are described. [provided by RefSeq, Jul 2013]
Mouse(21815) TGFB-induced factor homeobox 1
Rat(316742) TGFB-induced factor homeobox 1
Zebrafish(321756) TGFB-induced factor homeobox 1
chicken(396339) TGFB-induced factor homeobox 1
dog(490537) TGFB-induced factor homeobox 1
domestic cat(101084747) TGFB-induced factor homeobox 1
domestic guinea pig(100716233) TGFB-induced factor homeobox 1
naked mole-rat(101698504) TGFB-induced factor homeobox 1
cow(510050) TGFB-induced factor homeobox 1
sheep(101105544) TGFB-induced factor homeobox 1
162 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009372 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009372 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009372 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003244 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003244 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003244 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003244 Rosetta Predictions human pricing
NM_170695 Rosetta Predictions human pricing
NM_173207 Rosetta Predictions human pricing
NM_173208 Rosetta Predictions human pricing
NM_173209 Rosetta Predictions human pricing
NM_173210 Rosetta Predictions human pricing
NM_173211 Rosetta Predictions human pricing
NM_174886 Rosetta Predictions human pricing
NM_001015020 Rosetta Predictions rat pricing
NM_009372 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003244 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196951 predicted 537
2 SASI_Hs01_00196952 predicted 625
3 SASI_Hs01_00196953 predicted 938
4 SASI_Hs01_00196954 predicted 558
5 SASI_Hs01_00196955 predicted 822
6 SASI_Hs01_00196956 predicted 842
7 SASI_Hs01_00196957 predicted 546
8 SASI_Hs01_00196958 predicted 615
9 SASI_Hs01_00196960 predicted 665
10 SASI_Hs02_00335283 predicted 839
11 SASI_Hs01_00196959 predicted 555
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170695 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133489 predicted 1002
2 SASI_Hs01_00133490 predicted 1077
3 SASI_Hs01_00133491 predicted 1395
4 SASI_Hs01_00133492 predicted 1014
5 SASI_Hs01_00133493 predicted 1274
6 SASI_Hs01_00133494 predicted 1296
7 SASI_Hs01_00133495 predicted 997
8 SASI_Hs01_00133496 predicted 1076
9 SASI_Hs01_00133498 predicted 1120
10 SASI_Hs02_00367629 predicted 1294
11 SASI_Hs01_00133497 predicted 1007
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173207 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161365 predicted 396
2 SASI_Hs01_00161366 predicted 474
3 SASI_Hs01_00161367 predicted 792
4 SASI_Hs01_00161368 predicted 408
5 SASI_Hs01_00161369 predicted 676
6 SASI_Hs01_00161370 predicted 696
7 SASI_Hs01_00161371 predicted 404
8 SASI_Hs01_00161372 predicted 467
9 SASI_Hs01_00161374 predicted 525
10 SASI_Hs02_00368163 predicted 691
11 SASI_Hs01_00161373 predicted 406
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173208 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228632 predicted 433
2 SASI_Hs01_00228633 predicted 512
3 SASI_Hs01_00228634 predicted 825
4 SASI_Hs01_00228635 predicted 444
5 SASI_Hs01_00228636 predicted 706
6 SASI_Hs01_00228637 predicted 731
7 SASI_Hs01_00228638 predicted 436
8 SASI_Hs01_00228639 predicted 502
9 SASI_Hs01_00228641 predicted 560
10 SASI_Hs02_00368164 predicted 732
11 SASI_Hs01_00228640 predicted 443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173209 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090439 predicted 302
2 SASI_Hs01_00090440 predicted 383
3 SASI_Hs01_00090441 predicted 702
4 SASI_Hs01_00090442 predicted 322
5 SASI_Hs01_00090443 predicted 581
6 SASI_Hs01_00090444 predicted 602
7 SASI_Hs01_00090445 predicted 306
8 SASI_Hs01_00090446 predicted 384
9 SASI_Hs01_00090448 predicted 430
10 SASI_Hs02_00368165 predicted 599
11 SASI_Hs01_00090447 predicted 315
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173210 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026851 predicted 395
2 SASI_Hs01_00026852 predicted 467
3 SASI_Hs01_00026853 predicted 787
4 SASI_Hs01_00026854 predicted 410
5 SASI_Hs01_00026855 predicted 665
6 SASI_Hs01_00026856 predicted 693
7 SASI_Hs01_00026857 predicted 396
8 SASI_Hs01_00026858 predicted 467
9 SASI_Hs01_00026860 predicted 514
10 SASI_Hs02_00368166 predicted 691
11 SASI_Hs01_00026859 predicted 410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173211 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164524 predicted 291
2 SASI_Hs01_00164525 predicted 370
3 SASI_Hs01_00164526 predicted 684
4 SASI_Hs01_00164527 predicted 305
5 SASI_Hs01_00164528 predicted 567
6 SASI_Hs01_00164529 predicted 594
7 SASI_Hs01_00164530 predicted 296
8 SASI_Hs01_00164531 predicted 362
9 SASI_Hs01_00164533 predicted 414
10 SASI_Hs02_00368167 predicted 591
11 SASI_Hs01_00164532 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174886 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214221 predicted 466
2 SASI_Hs01_00214222 predicted 545
3 SASI_Hs01_00214223 predicted 858
4 SASI_Hs01_00214224 predicted 479
5 SASI_Hs01_00214225 predicted 743
6 SASI_Hs01_00214226 predicted 763
7 SASI_Hs01_00214227 predicted 468
8 SASI_Hs01_00214228 predicted 538
9 SASI_Hs01_00214230 predicted 585
10 SASI_Hs02_00368749 predicted 758
11 SASI_Hs01_00214229 predicted 472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015020 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202059 predicted 659
2 SASI_Rn02_00202060 predicted 428
3 SASI_Rn02_00202061 predicted 217
4 SASI_Rn02_00202062 predicted 873
5 SASI_Rn02_00202063 predicted 241
6 SASI_Rn02_00202064 predicted 769
7 SASI_Rn02_00202065 predicted 858
8 SASI_Rn02_00202066 predicted 906
9 SASI_Rn02_00202067 predicted 435
10 SASI_Rn02_00202068 predicted 805
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009372 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071273 predicted 738
2 SASI_Mm01_00071274 predicted 900
3 SASI_Mm01_00071275 predicted 924
4 SASI_Mm01_00071276 predicted 666
5 SASI_Mm01_00071277 predicted 563
6 SASI_Mm02_00315978 predicted 1297
7 SASI_Mm01_00071278 predicted 622
8 SASI_Mm01_00071279 predicted 724
9 SASI_Mm01_00071280 predicted 437
10 SASI_Mm01_00071281 predicted 321
11 SASI_Mm01_00071282 predicted 938
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009372
VALIDATED
TGIF1 MISSION shRNA Bacterial Glycerol Stock
TGFB-induced factor homeobox 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009372.2-671s21c1
Sequence:CCGGATTTCAGAAGCTAGCTCTATTCTCGAGAATAGAGCTAGCTTCTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009372.2-1195s21c1
Sequence:GTACCGGGATGGCAAGAGATGCATTATTCTCGAGAATAATGCATCTCTTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009372.2-1352s21c1
Sequence:GTACCGGCGAATGTTTCTTGGTAGTTTCCTCGAGGAAACTACCAAGAAACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009372.2-1080s21c1
Sequence:CCGGTAGTGGATGTTGCACTCAAACCTCGAGGTTTGAGTGCAACATCCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009372.2-911s21c1
Sequence:CCGGAGTACAGATGTACCGCAAATACTCGAGTATTTGCGGTACATCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009372.2-1079s1c1
Sequence:CCGGCTAGTGGATGTTGCACTCAAACTCGAGTTTGAGTGCAACATCCACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009372.2-909s1c1
Sequence:CCGGAGAGTACAGATGTACCGCAAACTCGAGTTTGCGGTACATCTGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009372.2-488s1c1
Sequence:CCGGGAACACAGATACAACGCCTATCTCGAGATAGGCGTTGTATCTGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009372.2-632s1c1
Sequence:CCGGGATCCAAATCAGTTCACGATTCTCGAGAATCGTGAACTGATTTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009372.2-740s1c1
Sequence:CCGGCCATTTCATTCCTGCGTAGTTCTCGAGAACTACGCAGGAATGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009372
VALIDATED
TGIF1 MISSION shRNA shRNA Plasmid DNA
TGFB-induced factor homeobox 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009372.2-671s21c1
Sequence:CCGGATTTCAGAAGCTAGCTCTATTCTCGAGAATAGAGCTAGCTTCTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009372.2-1195s21c1
Sequence:GTACCGGGATGGCAAGAGATGCATTATTCTCGAGAATAATGCATCTCTTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009372.2-1352s21c1
Sequence:GTACCGGCGAATGTTTCTTGGTAGTTTCCTCGAGGAAACTACCAAGAAACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009372.2-1080s21c1
Sequence:CCGGTAGTGGATGTTGCACTCAAACCTCGAGGTTTGAGTGCAACATCCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009372.2-911s21c1
Sequence:CCGGAGTACAGATGTACCGCAAATACTCGAGTATTTGCGGTACATCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009372.2-1079s1c1
Sequence:CCGGCTAGTGGATGTTGCACTCAAACTCGAGTTTGAGTGCAACATCCACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009372.2-909s1c1
Sequence:CCGGAGAGTACAGATGTACCGCAAACTCGAGTTTGCGGTACATCTGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009372.2-488s1c1
Sequence:CCGGGAACACAGATACAACGCCTATCTCGAGATAGGCGTTGTATCTGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009372.2-632s1c1
Sequence:CCGGGATCCAAATCAGTTCACGATTCTCGAGAATCGTGAACTGATTTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009372.2-740s1c1
Sequence:CCGGCCATTTCATTCCTGCGTAGTTCTCGAGAACTACGCAGGAATGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009372
VALIDATED
TGIF1 MISSION shRNA Lentiviral Transduction Particles
TGFB-induced factor homeobox 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009372.2-671s21c1
Sequence:CCGGATTTCAGAAGCTAGCTCTATTCTCGAGAATAGAGCTAGCTTCTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009372.2-1195s21c1
Sequence:GTACCGGGATGGCAAGAGATGCATTATTCTCGAGAATAATGCATCTCTTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009372.2-1352s21c1
Sequence:GTACCGGCGAATGTTTCTTGGTAGTTTCCTCGAGGAAACTACCAAGAAACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009372.2-1080s21c1
Sequence:CCGGTAGTGGATGTTGCACTCAAACCTCGAGGTTTGAGTGCAACATCCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009372.2-911s21c1
Sequence:CCGGAGTACAGATGTACCGCAAATACTCGAGTATTTGCGGTACATCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009372.2-1079s1c1
Sequence:CCGGCTAGTGGATGTTGCACTCAAACTCGAGTTTGAGTGCAACATCCACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009372.2-909s1c1
Sequence:CCGGAGAGTACAGATGTACCGCAAACTCGAGTTTGCGGTACATCTGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009372.2-488s1c1
Sequence:CCGGGAACACAGATACAACGCCTATCTCGAGATAGGCGTTGTATCTGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009372.2-632s1c1
Sequence:CCGGGATCCAAATCAGTTCACGATTCTCGAGAATCGTGAACTGATTTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009372.2-740s1c1
Sequence:CCGGCCATTTCATTCCTGCGTAGTTCTCGAGAACTACGCAGGAATGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003244
VALIDATED
TGIF1 MISSION shRNA Bacterial Glycerol Stock
TGFB-induced factor homeobox 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000020151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003244.2-972s1c1
Sequence:CCGGCTTGTAAATCTGGACCAAGTACTCGAGTACTTGGTCCAGATTTACAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003244.2-453s1c1
Sequence:CCGGCTGTGCAGATTCTTCGGGATTCTCGAGAATCCCGAAGAATCTGCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_003244.2-531s1c1
Sequence:CCGGCCCAGCAAACACACCTGTCTACTCGAGTAGACAGGTGTGTTTGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003244.2-993s1c1
Sequence:CCGGCGAATACACAGAGTGGTCTTTCTCGAGAAAGACCACTCTGTGTATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003244
VALIDATED
TGIF1 MISSION shRNA shRNA Plasmid DNA
TGFB-induced factor homeobox 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000020151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003244.2-972s1c1
Sequence:CCGGCTTGTAAATCTGGACCAAGTACTCGAGTACTTGGTCCAGATTTACAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003244.2-453s1c1
Sequence:CCGGCTGTGCAGATTCTTCGGGATTCTCGAGAATCCCGAAGAATCTGCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_003244.2-531s1c1
Sequence:CCGGCCCAGCAAACACACCTGTCTACTCGAGTAGACAGGTGTGTTTGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003244.2-993s1c1
Sequence:CCGGCGAATACACAGAGTGGTCTTTCTCGAGAAAGACCACTCTGTGTATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003244
VALIDATED
TGIF1 MISSION shRNA Lentiviral Transduction Particles
TGFB-induced factor homeobox 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000020151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003244.2-972s1c1
Sequence:CCGGCTTGTAAATCTGGACCAAGTACTCGAGTACTTGGTCCAGATTTACAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003244.2-453s1c1
Sequence:CCGGCTGTGCAGATTCTTCGGGATTCTCGAGAATCCCGAAGAATCTGCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_003244.2-531s1c1
Sequence:CCGGCCCAGCAAACACACCTGTCTACTCGAGTAGACAGGTGTGTTTGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003244.2-993s1c1
Sequence:CCGGCGAATACACAGAGTGGTCTTTCTCGAGAAAGACCACTCTGTGTATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks