EMAIL THIS PAGE TO A FRIEND

TGIF2

TGFB-induced factor homeobox 2

UniProtKB ID: Q9GZN2, B2R9U3, E1P5T9, H0YNI0
Gene ID:
Human(60436) Summary: The protein encoded by this gene is a DNA-binding homeobox protein and a transcriptional repressor, which appears to repress transcription by recruiting histone deacetylases to TGF beta-responsive genes. This gene is amplified and over-expressed in some ovarian cancers. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 1. Read-through transcription also exists between this gene and the neighboring downstream C20orf24 (chromosome 20 open reading frame 24) gene. [provided by RefSeq, Dec 2010]
Mouse(228839) TGFB-induced factor homeobox 2
Rat(499929) TGFB-induced factor homeobox 2
chicken(428131) TGFB-induced factor homeobox 2
dog(485857) TGFB-induced factor homeobox 2
cow(535632) TGFB-induced factor homeobox 2
184 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
GW22325F Anti-TGIF2 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB2501033 Anti-TGIF2 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, canine, mouse, rat
ELISA, western blot pricing
SAB1412216 ANTI-TGIF2 antibody produced in mouse clone 5B11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412224 ANTI-TGIF2 antibody produced in mouse clone 5G1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412227 ANTI-TGIF2 antibody produced in mouse clone 5G6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412625 ANTI-TGIF2 antibody produced in mouse clone 6B10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411197 Anti-TGIF2 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA053786 Anti-TGIF2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
WH0060436M1 Monoclonal Anti-TGIF2 antibody produced in mouse clone 4C10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1405236 Monoclonal Anti-TGIF2, (C-terminal) antibody produced in mouse clone 6A8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021809 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021809 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021809 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173396 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173396 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173396 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU024421 MISSION® esiRNA esiRNA human TGIF2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021809 Rosetta Predictions human pricing
NM_001134983 Rosetta Predictions rat pricing
NM_173396 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021809 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107440 predicted 343
2 SASI_Hs01_00107441 predicted 427
3 SASI_Hs01_00107442 predicted 1108
4 SASI_Hs01_00107443 predicted 427
5 SASI_Hs02_00355121 predicted 852
6 SASI_Hs01_00107444 predicted 341
7 SASI_Hs01_00107446 predicted 1024
8 SASI_Hs01_00107447 predicted 921
9 SASI_Hs01_00107448 predicted 782
10 SASI_Hs01_00107449 predicted 944
11 SASI_Hs01_00107445 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134983 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259234 predicted 977
2 SASI_Rn02_00259235 predicted 992
3 SASI_Rn02_00259236 predicted 363
4 SASI_Rn02_00259237 predicted 1367
5 SASI_Rn02_00259238 predicted 1367
6 SASI_Rn02_00259239 predicted 998
7 SASI_Rn02_00259240 predicted 840
8 SASI_Rn02_00259241 predicted 795
9 SASI_Rn02_00259242 predicted 1247
10 SASI_Rn02_00259243 predicted 598
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173396 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345231 predicted 976
2 SASI_Mm01_00176380 predicted 1270
3 SASI_Mm01_00176382 predicted 1306
4 SASI_Mm01_00176383 predicted 1317
5 SASI_Mm02_00345232 predicted 945
6 SASI_Mm02_00345233 predicted 1168
7 SASI_Mm02_00345234 predicted 948
8 SASI_Mm01_00176384 predicted 342
9 SASI_Mm01_00176385 predicted 1258
10 SASI_Mm02_00345235 predicted 959
11 SASI_Mm01_00176379 predicted 763
12 SASI_Mm01_00176381 predicted 265
13 SASI_Mm01_00176386 predicted 239
14 SASI_Mm01_00176387 predicted 635
15 SASI_Mm01_00176388 predicted 233
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021809
VALIDATED
TGIF2 MISSION shRNA Bacterial Glycerol Stock
TGFB-induced factor homeobox 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021809.4-346s1c1
Sequence:CCGGGCTGCAAATATGTAACTGGTTCTCGAGAACCAGTTACATATTTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021809.4-843s1c1
Sequence:CCGGCCATCCCTTTAGTCTCTGAAACTCGAGTTTCAGAGACTAAAGGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021809.4-419s1c1
Sequence:CCGGGACCCTAATCAGTTTACCATTCTCGAGAATGGTAAACTGATTAGGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018058    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021809.4-2180s1c1
Sequence:CCGGGCCCAGTGAACAGATAACAATCTCGAGATTGTTATCTGTTCACTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021809.4-235s1c1
Sequence:CCGGGCCCAAGGAGTCGGTGAAGATCTCGAGATCTTCACCGACTCCTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335962    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021809.5-1283s21c1
Sequence:CCGGGTGGACATTCCAAGTTCATATCTCGAGATATGAACTTGGAATGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021809.5-281s21c1
Sequence:CCGGGCTGTACTTGCACCGCTACAACTCGAGTTGTAGCGGTGCAAGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021809.5-432s21c1
Sequence:CCGGGACCCTAATCAGTTTACCATTCTCGAGAATGGTAAACTGATTAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021809.5-856s21c1
Sequence:CCGGCCATCCCTTTAGTCTCTGAAACTCGAGTTTCAGAGACTAAAGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021809.5-825s21c1
Sequence:CCGGCAGGACCCATCACTCCCATTACTCGAGTAATGGGAGTGATGGGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021809
VALIDATED
TGIF2 MISSION shRNA shRNA Plasmid DNA
TGFB-induced factor homeobox 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021809.4-346s1c1
Sequence:CCGGGCTGCAAATATGTAACTGGTTCTCGAGAACCAGTTACATATTTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021809.4-843s1c1
Sequence:CCGGCCATCCCTTTAGTCTCTGAAACTCGAGTTTCAGAGACTAAAGGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021809.4-419s1c1
Sequence:CCGGGACCCTAATCAGTTTACCATTCTCGAGAATGGTAAACTGATTAGGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018058    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021809.4-2180s1c1
Sequence:CCGGGCCCAGTGAACAGATAACAATCTCGAGATTGTTATCTGTTCACTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021809.4-235s1c1
Sequence:CCGGGCCCAAGGAGTCGGTGAAGATCTCGAGATCTTCACCGACTCCTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335962    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021809.5-1283s21c1
Sequence:CCGGGTGGACATTCCAAGTTCATATCTCGAGATATGAACTTGGAATGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021809.5-281s21c1
Sequence:CCGGGCTGTACTTGCACCGCTACAACTCGAGTTGTAGCGGTGCAAGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021809.5-432s21c1
Sequence:CCGGGACCCTAATCAGTTTACCATTCTCGAGAATGGTAAACTGATTAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021809.5-856s21c1
Sequence:CCGGCCATCCCTTTAGTCTCTGAAACTCGAGTTTCAGAGACTAAAGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021809.5-825s21c1
Sequence:CCGGCAGGACCCATCACTCCCATTACTCGAGTAATGGGAGTGATGGGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021809
VALIDATED
TGIF2 MISSION shRNA Lentiviral Transduction Particles
TGFB-induced factor homeobox 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021809.4-346s1c1
Sequence:CCGGGCTGCAAATATGTAACTGGTTCTCGAGAACCAGTTACATATTTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021809.4-843s1c1
Sequence:CCGGCCATCCCTTTAGTCTCTGAAACTCGAGTTTCAGAGACTAAAGGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021809.4-419s1c1
Sequence:CCGGGACCCTAATCAGTTTACCATTCTCGAGAATGGTAAACTGATTAGGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018058    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021809.4-2180s1c1
Sequence:CCGGGCCCAGTGAACAGATAACAATCTCGAGATTGTTATCTGTTCACTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021809.4-235s1c1
Sequence:CCGGGCCCAAGGAGTCGGTGAAGATCTCGAGATCTTCACCGACTCCTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335962    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021809.5-1283s21c1
Sequence:CCGGGTGGACATTCCAAGTTCATATCTCGAGATATGAACTTGGAATGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021809.5-281s21c1
Sequence:CCGGGCTGTACTTGCACCGCTACAACTCGAGTTGTAGCGGTGCAAGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021809.5-432s21c1
Sequence:CCGGGACCCTAATCAGTTTACCATTCTCGAGAATGGTAAACTGATTAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021809.5-856s21c1
Sequence:CCGGCCATCCCTTTAGTCTCTGAAACTCGAGTTTCAGAGACTAAAGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021809.5-825s21c1
Sequence:CCGGCAGGACCCATCACTCCCATTACTCGAGTAATGGGAGTGATGGGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173396
VALIDATED
TGIF2 MISSION shRNA Bacterial Glycerol Stock
TGFB-induced factor homeobox 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173396.1-2064s1c1
Sequence:CCGGCCCATCTTTATATCCTAAGAACTCGAGTTCTTAGGATATAAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173396.1-382s1c1
Sequence:CCGGGCTGCAGATATGTAACTGGTTCTCGAGAACCAGTTACATATCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173396.1-271s1c1
Sequence:CCGGGCCCAAGGAGTCAGTAAAGATCTCGAGATCTTTACTGACTCCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173396.1-857s1c1
Sequence:CCGGGCGCCACCTTTGCTACACACTCTCGAGAGTGTGTAGCAAAGGTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173396.1-385s1c1
Sequence:CCGGGCAGATATGTAACTGGTTCATCTCGAGATGAACCAGTTACATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173396.2-304s21c1
Sequence:CCGGGCTCTATCTGCACCGCTACAACTCGAGTTGTAGCGGTGCAGATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348998    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173396.2-1263s21c1
Sequence:CCGGGTGTGCACATTCCAACCTATTCTCGAGAATAGGTTGGAATGTGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173396.2-722s21c1
Sequence:CCGGACGGGTGGACTCTTCAATACGCTCGAGCGTATTGAAGAGTCCACCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173396.2-385s21c1
Sequence:CCGGGCAGATATGTAACTGGTTCATCTCGAGATGAACCAGTTACATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173396.2-857s21c1
Sequence:CCGGGCGCCACCTTTGCTACACACTCTCGAGAGTGTGTAGCAAAGGTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173396.2-271s21c1
Sequence:CCGGGCCCAAGGAGTCAGTAAAGATCTCGAGATCTTTACTGACTCCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173396
VALIDATED
TGIF2 MISSION shRNA shRNA Plasmid DNA
TGFB-induced factor homeobox 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173396.1-2064s1c1
Sequence:CCGGCCCATCTTTATATCCTAAGAACTCGAGTTCTTAGGATATAAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173396.1-382s1c1
Sequence:CCGGGCTGCAGATATGTAACTGGTTCTCGAGAACCAGTTACATATCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173396.1-271s1c1
Sequence:CCGGGCCCAAGGAGTCAGTAAAGATCTCGAGATCTTTACTGACTCCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173396.1-857s1c1
Sequence:CCGGGCGCCACCTTTGCTACACACTCTCGAGAGTGTGTAGCAAAGGTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173396.1-385s1c1
Sequence:CCGGGCAGATATGTAACTGGTTCATCTCGAGATGAACCAGTTACATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173396.2-304s21c1
Sequence:CCGGGCTCTATCTGCACCGCTACAACTCGAGTTGTAGCGGTGCAGATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348998    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173396.2-1263s21c1
Sequence:CCGGGTGTGCACATTCCAACCTATTCTCGAGAATAGGTTGGAATGTGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173396.2-722s21c1
Sequence:CCGGACGGGTGGACTCTTCAATACGCTCGAGCGTATTGAAGAGTCCACCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173396.2-385s21c1
Sequence:CCGGGCAGATATGTAACTGGTTCATCTCGAGATGAACCAGTTACATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173396.2-857s21c1
Sequence:CCGGGCGCCACCTTTGCTACACACTCTCGAGAGTGTGTAGCAAAGGTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173396.2-271s21c1
Sequence:CCGGGCCCAAGGAGTCAGTAAAGATCTCGAGATCTTTACTGACTCCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173396
VALIDATED
TGIF2 MISSION shRNA Lentiviral Transduction Particles
TGFB-induced factor homeobox 2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173396.1-2064s1c1
Sequence:CCGGCCCATCTTTATATCCTAAGAACTCGAGTTCTTAGGATATAAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173396.1-382s1c1
Sequence:CCGGGCTGCAGATATGTAACTGGTTCTCGAGAACCAGTTACATATCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173396.1-271s1c1
Sequence:CCGGGCCCAAGGAGTCAGTAAAGATCTCGAGATCTTTACTGACTCCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173396.1-857s1c1
Sequence:CCGGGCGCCACCTTTGCTACACACTCTCGAGAGTGTGTAGCAAAGGTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173396.1-385s1c1
Sequence:CCGGGCAGATATGTAACTGGTTCATCTCGAGATGAACCAGTTACATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173396.2-304s21c1
Sequence:CCGGGCTCTATCTGCACCGCTACAACTCGAGTTGTAGCGGTGCAGATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348998    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173396.2-1263s21c1
Sequence:CCGGGTGTGCACATTCCAACCTATTCTCGAGAATAGGTTGGAATGTGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173396.2-722s21c1
Sequence:CCGGACGGGTGGACTCTTCAATACGCTCGAGCGTATTGAAGAGTCCACCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173396.2-385s21c1
Sequence:CCGGGCAGATATGTAACTGGTTCATCTCGAGATGAACCAGTTACATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173396.2-857s21c1
Sequence:CCGGGCGCCACCTTTGCTACACACTCTCGAGAGTGTGTAGCAAAGGTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173396.2-271s21c1
Sequence:CCGGGCCCAAGGAGTCAGTAAAGATCTCGAGATCTTTACTGACTCCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks