EMAIL THIS PAGE TO A FRIEND

TGIF2LX

TGFB-induced factor homeobox 2-like, X-linked

Synonyms: TGIFLX
UniProtKB ID: Q8IUE1, Q5JRM9, Q8TD48
Gene ID:
Human(90316) Summary: This gene encodes a member of the TALE/TGIF homeobox family of transcription factors. Testis-specific expression suggests that this gene may play a role in spermatogenesis. A homolog of this gene lies within the male specific region of chromosome Y, in a block of sequence that is thought to be the result of a large X-to-Y transposition. [provided by RefSeq, Jul 2008]
domestic guinea pig(100725578) TGFB-induced factor homeobox 2-like, X-linked
naked mole-rat(101706251) TGFB-induced factor homeobox 2-like, X-linked
cow(789010) TGFB-induced factor homeobox 2-like, X-linked
dog(492001) TGFB-induced factor homeobox 2-like, X-linked
23 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138960 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138960 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138960 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138960 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138960 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121687 predicted 316
2 SASI_Hs01_00121688 predicted 249
3 SASI_Hs01_00121689 predicted 210
4 SASI_Hs01_00121690 predicted 302
5 SASI_Hs01_00121691 predicted 592
6 SASI_Hs01_00121692 predicted 362
7 SASI_Hs01_00121693 predicted 460
8 SASI_Hs01_00121694 predicted 247
9 SASI_Hs01_00121695 predicted 251
10 SASI_Hs01_00121696 predicted 373
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138960
TGIF2LX MISSION shRNA Bacterial Glycerol Stock
TGFB-induced factor homeobox 2-like, X-linked
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000415245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138960.3-587s21c1
Sequence:CCGGAGCCAGAAGCTCACCGGAATACTCGAGTATTCCGGTGAGCTTCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138960.3-365s21c1
Sequence:CCGGAGACGCATTCTCCCGGATATGCTCGAGCATATCCGGGAGAATGCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138960.3-334s1c1
Sequence:CCGGGCAGATTTCTAACTGGTTTATCTCGAGATAAACCAGTTAGAAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138960.3-138s1c1
Sequence:CCGGCCTCAATCATGTCGAGAAATACTCGAGTATTTCTCGACATGATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138960.3-304s1c1
Sequence:CCGGGCTGTCAGAGAAGACCAATTTCTCGAGAAATTGGTCTTCTCTGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138960.3-624s1c1
Sequence:CCGGAGGTCAAGGTTTCTGTCACATCTCGAGATGTGACAGAAACCTTGACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138960.3-245s1c1
Sequence:CCGGCGCGACTGGATGTATAAGCATCTCGAGATGCTTATACATCCAGTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138960
TGIF2LX MISSION shRNA shRNA Plasmid DNA
TGFB-induced factor homeobox 2-like, X-linked
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000415245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138960.3-587s21c1
Sequence:CCGGAGCCAGAAGCTCACCGGAATACTCGAGTATTCCGGTGAGCTTCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138960.3-365s21c1
Sequence:CCGGAGACGCATTCTCCCGGATATGCTCGAGCATATCCGGGAGAATGCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138960.3-334s1c1
Sequence:CCGGGCAGATTTCTAACTGGTTTATCTCGAGATAAACCAGTTAGAAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138960.3-138s1c1
Sequence:CCGGCCTCAATCATGTCGAGAAATACTCGAGTATTTCTCGACATGATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138960.3-304s1c1
Sequence:CCGGGCTGTCAGAGAAGACCAATTTCTCGAGAAATTGGTCTTCTCTGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138960.3-624s1c1
Sequence:CCGGAGGTCAAGGTTTCTGTCACATCTCGAGATGTGACAGAAACCTTGACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138960.3-245s1c1
Sequence:CCGGCGCGACTGGATGTATAAGCATCTCGAGATGCTTATACATCCAGTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138960
TGIF2LX MISSION shRNA Lentiviral Transduction Particles
TGFB-induced factor homeobox 2-like, X-linked
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000415245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138960.3-587s21c1
Sequence:CCGGAGCCAGAAGCTCACCGGAATACTCGAGTATTCCGGTGAGCTTCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138960.3-365s21c1
Sequence:CCGGAGACGCATTCTCCCGGATATGCTCGAGCATATCCGGGAGAATGCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138960.3-334s1c1
Sequence:CCGGGCAGATTTCTAACTGGTTTATCTCGAGATAAACCAGTTAGAAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138960.3-138s1c1
Sequence:CCGGCCTCAATCATGTCGAGAAATACTCGAGTATTTCTCGACATGATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138960.3-304s1c1
Sequence:CCGGGCTGTCAGAGAAGACCAATTTCTCGAGAAATTGGTCTTCTCTGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138960.3-624s1c1
Sequence:CCGGAGGTCAAGGTTTCTGTCACATCTCGAGATGTGACAGAAACCTTGACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138960.3-245s1c1
Sequence:CCGGCGCGACTGGATGTATAAGCATCTCGAGATGCTTATACATCCAGTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks