EMAIL THIS PAGE TO A FRIEND

TGIF2LY

TGFB-induced factor homeobox 2-like, Y-linked

Synonyms: TGIFLY
Species: Human TGIF2LY(90655)
UniProtKB ID: Q8IUE0, A2VCU1
Gene ID:
Human(90655) Summary: This gene encodes a member of the TALE/TGIF homeobox family of transcription factors. This gene lies within the male specific region of chromosome Y, in a block of sequence that is thought to be the result of a large X-to-Y transposition. The C-terminus of this protein is divergent from that of its chromosome X homolog (TGIF2LX), suggesting that this protein may act as a regulator of TGIF2LX. [provided by RefSeq, Jul 2008]
43 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV36141 Anti-TGIF2LY antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB2104856 Anti-TGIF2LY antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139214 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139214 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139214 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU112281 MISSION® esiRNA esiRNA human TGIF2LY (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139214 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139214 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204978 predicted 321
2 SASI_Hs01_00204979 predicted 259
3 SASI_Hs01_00204980 predicted 225
4 SASI_Hs01_00204981 predicted 597
5 SASI_Hs01_00204982 predicted 605
6 SASI_Hs01_00204983 predicted 636
7 SASI_Hs01_00204984 predicted 380
8 SASI_Hs01_00204985 predicted 614
9 SASI_Hs01_00204986 predicted 254
10 SASI_Hs01_00204987 predicted 263
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139214
TGIF2LY MISSION shRNA Bacterial Glycerol Stock
TGFB-induced factor homeobox 2-like, Y-linked
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139214.2-615s21c1
Sequence:CCGGCGGAATAGCCCAGCCAAAGAACTCGAGTTCTTTGGCTGGGCTATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416333    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139214.2-638s21c1
Sequence:CCGGAGGTCAAGATTTCTATCACTTCTCGAGAAGTGATAGAAATCTTGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139214.2-349s1c1
Sequence:CCGGGCGGATTTCTAACTGGTTTATCTCGAGATAAACCAGTTAGAAATCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139214.2-393s1c1
Sequence:CCGGCGGATATGCTTCAACAGCGTACTCGAGTACGCTGTTGAAGCATATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139214.2-162s1c1
Sequence:CCGGTGTCGAGAAATAACGCAGATACTCGAGTATCTGCGTTATTTCTCGACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139214.2-565s1c1
Sequence:CCGGTCAAGAGAGAAGCAACCAGATCTCGAGATCTGGTTGCTTCTCTCTTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139214.2-296s1c1
Sequence:CCGGCCTTCAGAAGAAGAGAAGCAACTCGAGTTGCTTCTCTTCTTCTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139214
TGIF2LY MISSION shRNA shRNA Plasmid DNA
TGFB-induced factor homeobox 2-like, Y-linked
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139214.2-615s21c1
Sequence:CCGGCGGAATAGCCCAGCCAAAGAACTCGAGTTCTTTGGCTGGGCTATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416333    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139214.2-638s21c1
Sequence:CCGGAGGTCAAGATTTCTATCACTTCTCGAGAAGTGATAGAAATCTTGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139214.2-349s1c1
Sequence:CCGGGCGGATTTCTAACTGGTTTATCTCGAGATAAACCAGTTAGAAATCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139214.2-393s1c1
Sequence:CCGGCGGATATGCTTCAACAGCGTACTCGAGTACGCTGTTGAAGCATATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139214.2-162s1c1
Sequence:CCGGTGTCGAGAAATAACGCAGATACTCGAGTATCTGCGTTATTTCTCGACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139214.2-565s1c1
Sequence:CCGGTCAAGAGAGAAGCAACCAGATCTCGAGATCTGGTTGCTTCTCTCTTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139214.2-296s1c1
Sequence:CCGGCCTTCAGAAGAAGAGAAGCAACTCGAGTTGCTTCTCTTCTTCTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139214
TGIF2LY MISSION shRNA Lentiviral Transduction Particles
TGFB-induced factor homeobox 2-like, Y-linked
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139214.2-615s21c1
Sequence:CCGGCGGAATAGCCCAGCCAAAGAACTCGAGTTCTTTGGCTGGGCTATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416333    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139214.2-638s21c1
Sequence:CCGGAGGTCAAGATTTCTATCACTTCTCGAGAAGTGATAGAAATCTTGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139214.2-349s1c1
Sequence:CCGGGCGGATTTCTAACTGGTTTATCTCGAGATAAACCAGTTAGAAATCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139214.2-393s1c1
Sequence:CCGGCGGATATGCTTCAACAGCGTACTCGAGTACGCTGTTGAAGCATATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139214.2-162s1c1
Sequence:CCGGTGTCGAGAAATAACGCAGATACTCGAGTATCTGCGTTATTTCTCGACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139214.2-565s1c1
Sequence:CCGGTCAAGAGAGAAGCAACCAGATCTCGAGATCTGGTTGCTTCTCTCTTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139214.2-296s1c1
Sequence:CCGGCCTTCAGAAGAAGAGAAGCAACTCGAGTTGCTTCTCTTCTTCTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks