EMAIL THIS PAGE TO A FRIEND

TGM1

transglutaminase 1

Synonyms: ARCI1 ICR2 KTG LI LI1 TGASE TGK
UniProtKB ID: P22735, Q197M4
Gene ID:
Human(7051) Summary: The protein encoded by this gene is a membrane protein that catalyzes the addition of an alkyl group from an akylamine to a glutamine residue of a protein, forming an alkylglutamine in the protein. This protein alkylation leads to crosslinking of proteins and catenation of polyamines to proteins. This gene contains either one or two copies of a 22 nt repeat unit in its 3' UTR. Mutations in this gene have been associated with autosomal recessive lamellar ichthyosis (LI) and nonbullous congenital ichthyosiform erythroderma (NCIE). [provided by RefSeq, Jul 2008]
Mouse(21816) transglutaminase 1, K polypeptide
Rat(60335) transglutaminase 1
cow(407997) transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase)
sheep(101114274) transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase)
domestic guinea pig(100724400) transglutaminase 1
naked mole-rat(101723323) transglutaminase 1
Domestic Rabbit(100009118) transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase)
Zebrafish(555558) transglutaminase 1, K polypeptide
domestic cat(101082066) transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase)
dog(403630) transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase)
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000359 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000359 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000359 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019984 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019984 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019984 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU026081 MISSION® esiRNA esiRNA human TGM1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000359 siRNAs that have been validated in the lab human pricing
NM_031659 Rosetta Predictions rat pricing
NM_019984 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000359 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024311 validated 2373
1 SASI_Hs01_00024310 validated 1030
1 SASI_Hs01_00024312 validated 1905
2 SASI_Hs02_00302405 predicted 919
3 SASI_Hs02_00302406 predicted 758
4 SASI_Hs01_00024314 predicted 1360
5 SASI_Hs01_00024315 predicted 1736
6 SASI_Hs02_00302407 predicted 1251
7 SASI_Hs01_00024317 predicted 616
8 SASI_Hs02_00302408 predicted 1466
9 SASI_Hs01_00024318 predicted 2284
10 SASI_Hs01_00024319 predicted 1615
11 SASI_Hs01_00024313 predicted 1214
12 SASI_Hs01_00024316 predicted 2204
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031659 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110344 predicted 2445
2 SASI_Rn01_00110345 predicted 2413
3 SASI_Rn01_00110346 predicted 982
4 SASI_Rn01_00110347 predicted 841
5 SASI_Rn01_00110348 predicted 940
6 SASI_Rn01_00110349 predicted 1980
7 SASI_Rn01_00110350 predicted 917
8 SASI_Rn01_00110351 predicted 1574
9 SASI_Rn01_00110352 predicted 2381
10 SASI_Rn01_00110353 predicted 2311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019984 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020256 predicted 1389
2 SASI_Mm01_00020258 predicted 872
3 SASI_Mm01_00020259 predicted 1383
4 SASI_Mm01_00020260 predicted 792
5 SASI_Mm01_00020262 predicted 1767
6 SASI_Mm01_00020263 predicted 2009
7 SASI_Mm01_00020264 predicted 2335
8 SASI_Mm02_00325325 predicted 1600
9 SASI_Mm01_00020265 predicted 910
10 SASI_Mm02_00325326 predicted 2486
11 SASI_Mm01_00020257 predicted 947
12 SASI_Mm01_00020261 predicted 1608
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000359
TGM1 MISSION shRNA Bacterial Glycerol Stock
transglutaminase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000359.1-543s1c1
Sequence:CCGGCGGACCTATGAATCCTCTGATCTCGAGATCAGAGGATTCATAGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000359.1-571s1c1
Sequence:CCGGCCCTTGAGTTACTCATCGGAACTCGAGTTCCGATGAGTAACTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000359.1-1265s1c1
Sequence:CCGGCCGTACTGTCACCAACTTCAACTCGAGTTGAAGTTGGTGACAGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000359.1-2492s1c1
Sequence:CCGGCTTAGGAGAGACCATCCCTATCTCGAGATAGGGATGGTCTCTCCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000359.1-1649s1c1
Sequence:CCGGCGGCACACTCATTGTCACAAACTCGAGTTTGTGACAATGAGTGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000359.2-1215s21c1
Sequence:CCGGGCTACCTACGCACGGGATATTCTCGAGAATATCCCGTGCGTAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000359.2-1739s21c1
Sequence:CCGGGACATCACCTACCTCTATAAGCTCGAGCTTATAGAGGTAGGTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000359.2-269s21c1
Sequence:CCGGGGCTGCTGTTCATGCCGAAATCTCGAGATTTCGGCATGAACAGCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000359.2-507s21c1
Sequence:CCGGAGCACCACACAGACGAGTATGCTCGAGCATACTCGTCTGTGTGGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000359.2-913s21c1
Sequence:CCGGGCGGCAGGAGTATGTTCTTAACTCGAGTTAAGAACATACTCCTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000359
TGM1 MISSION shRNA shRNA Plasmid DNA
transglutaminase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000359.1-543s1c1
Sequence:CCGGCGGACCTATGAATCCTCTGATCTCGAGATCAGAGGATTCATAGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000359.1-571s1c1
Sequence:CCGGCCCTTGAGTTACTCATCGGAACTCGAGTTCCGATGAGTAACTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000359.1-1265s1c1
Sequence:CCGGCCGTACTGTCACCAACTTCAACTCGAGTTGAAGTTGGTGACAGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000359.1-2492s1c1
Sequence:CCGGCTTAGGAGAGACCATCCCTATCTCGAGATAGGGATGGTCTCTCCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000359.1-1649s1c1
Sequence:CCGGCGGCACACTCATTGTCACAAACTCGAGTTTGTGACAATGAGTGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000359.2-1215s21c1
Sequence:CCGGGCTACCTACGCACGGGATATTCTCGAGAATATCCCGTGCGTAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000359.2-1739s21c1
Sequence:CCGGGACATCACCTACCTCTATAAGCTCGAGCTTATAGAGGTAGGTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000359.2-269s21c1
Sequence:CCGGGGCTGCTGTTCATGCCGAAATCTCGAGATTTCGGCATGAACAGCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000359.2-507s21c1
Sequence:CCGGAGCACCACACAGACGAGTATGCTCGAGCATACTCGTCTGTGTGGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000359.2-913s21c1
Sequence:CCGGGCGGCAGGAGTATGTTCTTAACTCGAGTTAAGAACATACTCCTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000359
TGM1 MISSION shRNA Lentiviral Transduction Particles
transglutaminase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000359.1-543s1c1
Sequence:CCGGCGGACCTATGAATCCTCTGATCTCGAGATCAGAGGATTCATAGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000359.1-571s1c1
Sequence:CCGGCCCTTGAGTTACTCATCGGAACTCGAGTTCCGATGAGTAACTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000359.1-1265s1c1
Sequence:CCGGCCGTACTGTCACCAACTTCAACTCGAGTTGAAGTTGGTGACAGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000359.1-2492s1c1
Sequence:CCGGCTTAGGAGAGACCATCCCTATCTCGAGATAGGGATGGTCTCTCCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000359.1-1649s1c1
Sequence:CCGGCGGCACACTCATTGTCACAAACTCGAGTTTGTGACAATGAGTGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000359.2-1215s21c1
Sequence:CCGGGCTACCTACGCACGGGATATTCTCGAGAATATCCCGTGCGTAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000359.2-1739s21c1
Sequence:CCGGGACATCACCTACCTCTATAAGCTCGAGCTTATAGAGGTAGGTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000359.2-269s21c1
Sequence:CCGGGGCTGCTGTTCATGCCGAAATCTCGAGATTTCGGCATGAACAGCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000359.2-507s21c1
Sequence:CCGGAGCACCACACAGACGAGTATGCTCGAGCATACTCGTCTGTGTGGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000359.2-913s21c1
Sequence:CCGGGCGGCAGGAGTATGTTCTTAACTCGAGTTAAGAACATACTCCTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019984
TGM1 MISSION shRNA Bacterial Glycerol Stock
transglutaminase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019984.2-1617s1c1
Sequence:CCGGGAAGTATGACACACCTTTCATCTCGAGATGAAAGGTGTGTCATACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104685    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019984.2-2621s1c1
Sequence:CCGGGCAATGGGACTGGAATCAGATCTCGAGATCTGATTCCAGTCCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019984.2-945s1c1
Sequence:CCGGGCGGCAAGAATATGTGCTTAACTCGAGTTAAGCACATATTCTTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019984.2-2226s1c1
Sequence:CCGGCCCAGACCTTTCTCTTACGTTCTCGAGAACGTAAGAGAAAGGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019984.2-1440s1c1
Sequence:CCGGCCATGATTCTGTTTGGAACTTCTCGAGAAGTTCCAAACAGAATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019984
TGM1 MISSION shRNA shRNA Plasmid DNA
transglutaminase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019984.2-1617s1c1
Sequence:CCGGGAAGTATGACACACCTTTCATCTCGAGATGAAAGGTGTGTCATACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104685    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019984.2-2621s1c1
Sequence:CCGGGCAATGGGACTGGAATCAGATCTCGAGATCTGATTCCAGTCCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019984.2-945s1c1
Sequence:CCGGGCGGCAAGAATATGTGCTTAACTCGAGTTAAGCACATATTCTTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019984.2-2226s1c1
Sequence:CCGGCCCAGACCTTTCTCTTACGTTCTCGAGAACGTAAGAGAAAGGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019984.2-1440s1c1
Sequence:CCGGCCATGATTCTGTTTGGAACTTCTCGAGAAGTTCCAAACAGAATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019984
TGM1 MISSION shRNA Lentiviral Transduction Particles
transglutaminase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019984.2-1617s1c1
Sequence:CCGGGAAGTATGACACACCTTTCATCTCGAGATGAAAGGTGTGTCATACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104685    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019984.2-2621s1c1
Sequence:CCGGGCAATGGGACTGGAATCAGATCTCGAGATCTGATTCCAGTCCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019984.2-945s1c1
Sequence:CCGGGCGGCAAGAATATGTGCTTAACTCGAGTTAAGCACATATTCTTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019984.2-2226s1c1
Sequence:CCGGCCCAGACCTTTCTCTTACGTTCTCGAGAACGTAAGAGAAAGGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019984.2-1440s1c1
Sequence:CCGGCCATGATTCTGTTTGGAACTTCTCGAGAAGTTCCAAACAGAATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks