EMAIL THIS PAGE TO A FRIEND

TGM2

transglutaminase 2

Synonyms: G-ALPHA-h GNAH TG2 TGC
UniProtKB ID: P21980, E1P5V9, Q16436, Q6B838, Q9BTN7, Q9UH35
Gene ID:
Human(7052) Summary: Transglutaminases are enzymes that catalyze the crosslinking of proteins by epsilon-gamma glutamyl lysine isopeptide bonds. While the primary structure of transglutaminases is not conserved, they all have the same amino acid sequence at their active sites and their activity is calcium-dependent. The protein encoded by this gene acts as a monomer, is induced by retinoic acid, and appears to be involved in apoptosis. Finally, the encoded protein is the autoantigen implicated in celiac disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(21817) transglutaminase 2, C polypeptide
Rat(56083) transglutaminase 2, C polypeptide
chicken(396432) transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase)
domestic cat(101098215) transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase)
dog(485867) transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase)
naked mole-rat(101699097) transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase)
domestic guinea pig(100379228) transglutaminase 2, C polypeptide
cow(281528) transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase)
sheep(101123140) transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase)
119 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV47471 Anti-TGM2 (AB1) antibody produced in rabbit affinity isolated antibody guinea pig, horse, bovine, mouse, rabbit, rat, zebrafish, human
western blot pricing
AV47472 Anti-TGM2 (AB2) antibody produced in rabbit affinity isolated antibody rabbit, mouse, guinea pig, rat, bovine, human, horse
western blot pricing
SAB2501034 Anti-TGM2 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB2502010 Anti-TGM2 antibody produced in goat affinity isolated antibody, buffered aqueous solution pig, mouse, bovine, rat, human
ELISA, western blot pricing
SAB1406528 Anti-TGM2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA021019 Anti-TGM2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA029518 Anti-TGM2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1306676 ANTI-TRANSGLUTAMINASE (TGM2) (CENTER K444) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1306047 ANTI-TRANSGLUTAMINASE (TGM2) (CENTER T428) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4502963 Anti-Transglutaminase 2, N-Terminal antibody produced in rabbit affinity isolated antibody mouse, human
pricing
T7066 Anti-Transglutaminase Type II antibody produced in goat whole antiserum mouse, guinea pig
immunoprecipitation, western blot pricing
SAB4200073 Anti-Transglutaminase-2 (C-terminal) antibody produced in rabbit ~1.5 mg/mL, affinity isolated antibody human
immunofluorescence, immunohistochemistry, immunoprecipitation, western blot pricing
SAB4200072 Anti-Transglutaminase-2 antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human
immunofluorescence, immunohistochemistry, immunoprecipitation, western blot pricing
WH0007052M10 Monoclonal Anti-TGM2 antibody produced in mouse clone 2F4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1404467 Monoclonal Anti-TGM2, (N-terminal) antibody produced in mouse clone 1A8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

Activity Assay

Product # Description Species Add to Cart
 
CS1070 Transglutaminase Assay Kit sufficient for assays in two 96-well plates human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009373 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009373 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009373 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004613 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004613 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004613 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004613 siRNAs that have been validated in the lab human pricing
NM_198951 Rosetta Predictions human pricing
NM_019386 Rosetta Predictions rat pricing
NM_009373 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004613 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035266 validated 1359
2 SASI_Hs01_00035265 predicted 676
3 SASI_Hs02_00338000 predicted 477
4 SASI_Hs01_00035269 predicted 1390
5 SASI_Hs01_00035270 predicted 1406
6 SASI_Hs01_00035272 predicted 592
7 SASI_Hs02_00338001 predicted 1407
8 SASI_Hs02_00338002 predicted 432
9 SASI_Hs02_00338003 predicted 1373
10 SASI_Hs02_00338004 predicted 1468
11 SASI_Hs02_00338005 predicted 763
12 SASI_Hs01_00035267 predicted 1260
13 SASI_Hs01_00035268 predicted 1197
14 SASI_Hs01_00035271 predicted 1068
15 SASI_Hs01_00035273 predicted 1325
16 SASI_Hs01_00035274 predicted 1069
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198951 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183835 predicted 677
2 SASI_Hs02_00372459 predicted 485
3 SASI_Hs01_00183839 predicted 1388
4 SASI_Hs01_00183840 predicted 1407
5 SASI_Hs01_00183842 predicted 584
6 SASI_Hs02_00372460 predicted 1411
7 SASI_Hs02_00372461 predicted 436
8 SASI_Hs02_00372462 predicted 1375
9 SASI_Hs02_00372463 predicted 1474
10 SASI_Hs02_00372464 predicted 760
11 SASI_Hs01_00183836 predicted 1359
12 SASI_Hs01_00183837 predicted 1253
13 SASI_Hs01_00183838 predicted 1205
14 SASI_Hs01_00183841 predicted 1067
15 SASI_Hs01_00183843 predicted 1324
16 SASI_Hs01_00183844 predicted 1077
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019386 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069019 predicted 1507
2 SASI_Rn01_00069020 predicted 1896
3 SASI_Rn01_00069021 predicted 438
4 SASI_Rn01_00069022 predicted 887
5 SASI_Rn01_00069023 predicted 1487
6 SASI_Rn01_00069024 predicted 2176
7 SASI_Rn02_00262429 predicted 1020
8 SASI_Rn01_00069025 predicted 2055
9 SASI_Rn01_00069026 predicted 1333
10 SASI_Rn01_00069027 predicted 993
11 SASI_Rn01_00069028 predicted 589
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009373 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102524 predicted 1713
2 SASI_Mm02_00315979 predicted 2055
3 SASI_Mm01_00102525 predicted 559
4 SASI_Mm01_00102526 predicted 1372
5 SASI_Mm01_00102527 predicted 1932
6 SASI_Mm01_00102528 predicted 1065
7 SASI_Mm01_00102529 predicted 2091
8 SASI_Mm01_00102530 predicted 1527
9 SASI_Mm01_00102531 predicted 1221
10 SASI_Mm02_00315980 predicted 2104
11 SASI_Mm01_00102532 predicted 428
12 SASI_Mm01_00102533 predicted 782
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009373
VALIDATED
TGM2 MISSION shRNA Bacterial Glycerol Stock
transglutaminase 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009373.3-1838s21c1
Sequence:CCGGCCTGGAGAATCCCGAAATCAACTCGAGTTGATTTCGGGATTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009373.3-1751s21c1
Sequence:CCGGCCTGACAGAGTCAAACCTCATCTCGAGATGAGGTTTGACTCTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009373.3-318s21c1
Sequence:CCGGCGCTTCTCACTGTCTGACAATCTCGAGATTGTCAGACAGTGAGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009373.3-561s21c1
Sequence:CCGGCGGGAATATGTCCTTACGCAACTCGAGTTGCGTAAGGACATATTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278097    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009373.3-2202s21c1
Sequence:CCGGCCTGGTCTTTATCCTAAGATACTCGAGTATCTTAGGATAAAGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009529    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009373.2-2202s1c1
Sequence:CCGGCCTGGTCTTTATCCTAAGATACTCGAGTATCTTAGGATAAAGACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009373.2-561s1c1
Sequence:CCGGCGGGAATATGTCCTTACGCAACTCGAGTTGCGTAAGGACATATTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009373.2-318s1c1
Sequence:CCGGCGCTTCTCACTGTCTGACAATCTCGAGATTGTCAGACAGTGAGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009373.2-1751s1c1
Sequence:CCGGCCTGACAGAGTCAAACCTCATCTCGAGATGAGGTTTGACTCTGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009373.2-1838s1c1
Sequence:CCGGCCTGGAGAATCCCGAAATCAACTCGAGTTGATTTCGGGATTCTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009373
VALIDATED
TGM2 MISSION shRNA shRNA Plasmid DNA
transglutaminase 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009373.3-1838s21c1
Sequence:CCGGCCTGGAGAATCCCGAAATCAACTCGAGTTGATTTCGGGATTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009373.3-1751s21c1
Sequence:CCGGCCTGACAGAGTCAAACCTCATCTCGAGATGAGGTTTGACTCTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009373.3-318s21c1
Sequence:CCGGCGCTTCTCACTGTCTGACAATCTCGAGATTGTCAGACAGTGAGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009373.3-561s21c1
Sequence:CCGGCGGGAATATGTCCTTACGCAACTCGAGTTGCGTAAGGACATATTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278097    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009373.3-2202s21c1
Sequence:CCGGCCTGGTCTTTATCCTAAGATACTCGAGTATCTTAGGATAAAGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009529    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009373.2-2202s1c1
Sequence:CCGGCCTGGTCTTTATCCTAAGATACTCGAGTATCTTAGGATAAAGACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009373.2-561s1c1
Sequence:CCGGCGGGAATATGTCCTTACGCAACTCGAGTTGCGTAAGGACATATTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009373.2-318s1c1
Sequence:CCGGCGCTTCTCACTGTCTGACAATCTCGAGATTGTCAGACAGTGAGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009373.2-1751s1c1
Sequence:CCGGCCTGACAGAGTCAAACCTCATCTCGAGATGAGGTTTGACTCTGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009373.2-1838s1c1
Sequence:CCGGCCTGGAGAATCCCGAAATCAACTCGAGTTGATTTCGGGATTCTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009373
VALIDATED
TGM2 MISSION shRNA Lentiviral Transduction Particles
transglutaminase 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009373.3-1838s21c1
Sequence:CCGGCCTGGAGAATCCCGAAATCAACTCGAGTTGATTTCGGGATTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009373.3-1751s21c1
Sequence:CCGGCCTGACAGAGTCAAACCTCATCTCGAGATGAGGTTTGACTCTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009373.3-318s21c1
Sequence:CCGGCGCTTCTCACTGTCTGACAATCTCGAGATTGTCAGACAGTGAGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009373.3-561s21c1
Sequence:CCGGCGGGAATATGTCCTTACGCAACTCGAGTTGCGTAAGGACATATTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278097    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009373.3-2202s21c1
Sequence:CCGGCCTGGTCTTTATCCTAAGATACTCGAGTATCTTAGGATAAAGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009529    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009373.2-2202s1c1
Sequence:CCGGCCTGGTCTTTATCCTAAGATACTCGAGTATCTTAGGATAAAGACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009373.2-561s1c1
Sequence:CCGGCGGGAATATGTCCTTACGCAACTCGAGTTGCGTAAGGACATATTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009373.2-318s1c1
Sequence:CCGGCGCTTCTCACTGTCTGACAATCTCGAGATTGTCAGACAGTGAGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009373.2-1751s1c1
Sequence:CCGGCCTGACAGAGTCAAACCTCATCTCGAGATGAGGTTTGACTCTGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009373.2-1838s1c1
Sequence:CCGGCCTGGAGAATCCCGAAATCAACTCGAGTTGATTTCGGGATTCTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004613
VALIDATED
TGM2 MISSION shRNA Bacterial Glycerol Stock
transglutaminase 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000272817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004613.2-1023s21c1
Sequence:CCGGACAGCAACCTTCTCATCGAGTCTCGAGACTCGATGAGAAGGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_004613.2-1414s21c1
Sequence:CCGGTATCACCCACACCTACAAATACTCGAGTATTTGTAGGTGTGGGTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272816    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004613.2-2484s21c1
Sequence:CCGGCCACCCACCATATTGTTTGATCTCGAGATCAAACAATATGGTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004613.2-1744s21c1
Sequence:CCGGTGAGAAATACCGTGACTGCCTCTCGAGAGGCAGTCACGGTATTTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_004613.2-489s21c1
Sequence:CCGGTTGTGCTGGGCCACTTCATTTCTCGAGAAATGAAGTGGCCCAGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004613.x-1781s1c1
Sequence:CCGGAGAAATACCGTGACTGCCTTACTCGAGTAAGGCAGTCACGGTATTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004613.x-1779s1c1
Sequence:CCGGTGAGAAATACCGTGACTGCCTCTCGAGAGGCAGTCACGGTATTTCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004613.x-2519s1c1
Sequence:CCGGCCACCCACCATATTGTTTGATCTCGAGATCAAACAATATGGTGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004613
VALIDATED
TGM2 MISSION shRNA shRNA Plasmid DNA
transglutaminase 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000272817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004613.2-1023s21c1
Sequence:CCGGACAGCAACCTTCTCATCGAGTCTCGAGACTCGATGAGAAGGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_004613.2-1414s21c1
Sequence:CCGGTATCACCCACACCTACAAATACTCGAGTATTTGTAGGTGTGGGTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272816    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004613.2-2484s21c1
Sequence:CCGGCCACCCACCATATTGTTTGATCTCGAGATCAAACAATATGGTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004613.2-1744s21c1
Sequence:CCGGTGAGAAATACCGTGACTGCCTCTCGAGAGGCAGTCACGGTATTTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_004613.2-489s21c1
Sequence:CCGGTTGTGCTGGGCCACTTCATTTCTCGAGAAATGAAGTGGCCCAGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004613.x-1781s1c1
Sequence:CCGGAGAAATACCGTGACTGCCTTACTCGAGTAAGGCAGTCACGGTATTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004613.x-1779s1c1
Sequence:CCGGTGAGAAATACCGTGACTGCCTCTCGAGAGGCAGTCACGGTATTTCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004613.x-2519s1c1
Sequence:CCGGCCACCCACCATATTGTTTGATCTCGAGATCAAACAATATGGTGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004613
VALIDATED
TGM2 MISSION shRNA Lentiviral Transduction Particles
transglutaminase 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000272817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004613.2-1023s21c1
Sequence:CCGGACAGCAACCTTCTCATCGAGTCTCGAGACTCGATGAGAAGGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_004613.2-1414s21c1
Sequence:CCGGTATCACCCACACCTACAAATACTCGAGTATTTGTAGGTGTGGGTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272816    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004613.2-2484s21c1
Sequence:CCGGCCACCCACCATATTGTTTGATCTCGAGATCAAACAATATGGTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004613.2-1744s21c1
Sequence:CCGGTGAGAAATACCGTGACTGCCTCTCGAGAGGCAGTCACGGTATTTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_004613.2-489s21c1
Sequence:CCGGTTGTGCTGGGCCACTTCATTTCTCGAGAAATGAAGTGGCCCAGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004613.x-1781s1c1
Sequence:CCGGAGAAATACCGTGACTGCCTTACTCGAGTAAGGCAGTCACGGTATTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004613.x-1779s1c1
Sequence:CCGGTGAGAAATACCGTGACTGCCTCTCGAGAGGCAGTCACGGTATTTCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004613.x-2519s1c1
Sequence:CCGGCCACCCACCATATTGTTTGATCTCGAGATCAAACAATATGGTGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks