EMAIL THIS PAGE TO A FRIEND

TGM3

transglutaminase 3

Synonyms: TGE
Gene ID:
Human(7053) Summary: Transglutaminases are enzymes that catalyze the crosslinking of proteins by epsilon-gamma glutamyl lysine isopeptide bonds. While the primary structure of transglutaminases is not conserved, they all have the same amino acid sequence at their active sites and their activity is calcium-dependent. The protein encoded by this gene consists of two polypeptide chains activated from a single precursor protein by proteolysis. The encoded protein is involved the later stages of cell envelope formation in the epidermis and hair follicle. [provided by RefSeq, Jul 2008]
Mouse(21818) transglutaminase 3, E polypeptide
Rat(366189) transglutaminase 3, E polypeptide
chicken(419215) transglutaminase 3 (E polypeptide, protein-glutamine-gamma-glutamyltransferase)
domestic cat(101083762) transglutaminase 3 (E polypeptide, protein-glutamine-gamma-glutamyltransferase)
Horse(100053068) transglutaminase 3 (E polypeptide, protein-glutamine-gamma-glutamyltransferase)
dog(477180) transglutaminase 3 (E polypeptide, protein-glutamine-gamma-glutamyltransferase)
cow(505080) transglutaminase 3 (E polypeptide, protein-glutamine-gamma-glutamyltransferase)
sheep(101105177) transglutaminase 3 (E polypeptide, protein-glutamine-gamma-glutamyltransferase)
domestic guinea pig(100718797) transglutaminase 3 (E polypeptide, protein-glutamine-gamma-glutamyltransferase)
naked mole-rat(101721908) transglutaminase 3 (E polypeptide, protein-glutamine-gamma-glutamyltransferase)
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Activity Assay

Product # Description Species Add to Cart
 
CS1070 Transglutaminase Assay Kit sufficient for assays in two 96-well plates human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003245 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003245 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003245 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009374 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009374 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009374 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003245 Rosetta Predictions human pricing
NM_001108959 Rosetta Predictions rat pricing
NM_009374 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003245 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219736 predicted 1426
2 SASI_Hs01_00219737 predicted 1703
3 SASI_Hs01_00219738 predicted 2064
4 SASI_Hs01_00219739 predicted 404
5 SASI_Hs01_00219740 predicted 729
6 SASI_Hs01_00219741 predicted 1729
7 SASI_Hs01_00219742 predicted 1163
8 SASI_Hs01_00219743 predicted 2070
9 SASI_Hs02_00335284 predicted 2129
10 SASI_Hs01_00219744 predicted 445
11 SASI_Hs01_00219745 predicted 936
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108959 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243774 predicted 937
2 SASI_Rn02_00243775 predicted 200
3 SASI_Rn02_00243776 predicted 1292
4 SASI_Rn02_00243777 predicted 636
5 SASI_Rn02_00243778 predicted 675
6 SASI_Rn02_00243779 predicted 753
7 SASI_Rn02_00243780 predicted 1725
8 SASI_Rn02_00243781 predicted 427
9 SASI_Rn02_00243782 predicted 1279
10 SASI_Rn02_00243783 predicted 1223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009374 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165111 predicted 404
2 SASI_Mm01_00165112 predicted 607
3 SASI_Mm01_00165113 predicted 1499
4 SASI_Mm01_00165114 predicted 1693
5 SASI_Mm01_00165115 predicted 1218
6 SASI_Mm01_00165117 predicted 475
7 SASI_Mm01_00165118 predicted 640
8 SASI_Mm01_00165119 predicted 715
9 SASI_Mm01_00165120 predicted 1159
10 SASI_Mm02_00315981 predicted 1836
11 SASI_Mm01_00165116 predicted 209
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003245
TGM3 MISSION shRNA Bacterial Glycerol Stock
transglutaminase 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003245.2-1441s1c1
Sequence:CCGGCGTCTTCAATGGGTTTGGAAACTCGAGTTTCCAAACCCATTGAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003245.2-2054s1c1
Sequence:CCGGCGACTTCTCCTGCAACAAGTTCTCGAGAACTTGTTGCAGGAGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003245.2-1195s1c1
Sequence:CCGGCCTTTATCTTCGCGGAGGTTACTCGAGTAACCTCCGCGAAGATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003245.2-182s1c1
Sequence:CCGGCTCTAACGAAAGACTGGAGTTCTCGAGAACTCCAGTCTTTCGTTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003245.3-1739s21c1
Sequence:CCGGGAGGCAGAACATCCCATAAAGCTCGAGCTTTATGGGATGTTCTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003245.3-1475s21c1
Sequence:CCGGCTTAAACCCAACACGCCATTTCTCGAGAAATGGCGTGTTGGGTTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003245.3-995s21c1
Sequence:CCGGGCTCATGACACAGACCGAAATCTCGAGATTTCGGTCTGTGTCATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003245
TGM3 MISSION shRNA shRNA Plasmid DNA
transglutaminase 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003245.2-1441s1c1
Sequence:CCGGCGTCTTCAATGGGTTTGGAAACTCGAGTTTCCAAACCCATTGAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003245.2-2054s1c1
Sequence:CCGGCGACTTCTCCTGCAACAAGTTCTCGAGAACTTGTTGCAGGAGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003245.2-1195s1c1
Sequence:CCGGCCTTTATCTTCGCGGAGGTTACTCGAGTAACCTCCGCGAAGATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003245.2-182s1c1
Sequence:CCGGCTCTAACGAAAGACTGGAGTTCTCGAGAACTCCAGTCTTTCGTTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003245.3-1739s21c1
Sequence:CCGGGAGGCAGAACATCCCATAAAGCTCGAGCTTTATGGGATGTTCTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003245.3-1475s21c1
Sequence:CCGGCTTAAACCCAACACGCCATTTCTCGAGAAATGGCGTGTTGGGTTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003245.3-995s21c1
Sequence:CCGGGCTCATGACACAGACCGAAATCTCGAGATTTCGGTCTGTGTCATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003245
TGM3 MISSION shRNA Lentiviral Transduction Particles
transglutaminase 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003245.2-1441s1c1
Sequence:CCGGCGTCTTCAATGGGTTTGGAAACTCGAGTTTCCAAACCCATTGAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003245.2-2054s1c1
Sequence:CCGGCGACTTCTCCTGCAACAAGTTCTCGAGAACTTGTTGCAGGAGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003245.2-1195s1c1
Sequence:CCGGCCTTTATCTTCGCGGAGGTTACTCGAGTAACCTCCGCGAAGATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003245.2-182s1c1
Sequence:CCGGCTCTAACGAAAGACTGGAGTTCTCGAGAACTCCAGTCTTTCGTTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003245.3-1739s21c1
Sequence:CCGGGAGGCAGAACATCCCATAAAGCTCGAGCTTTATGGGATGTTCTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003245.3-1475s21c1
Sequence:CCGGCTTAAACCCAACACGCCATTTCTCGAGAAATGGCGTGTTGGGTTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003245.3-995s21c1
Sequence:CCGGGCTCATGACACAGACCGAAATCTCGAGATTTCGGTCTGTGTCATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009374
TGM3 MISSION shRNA Bacterial Glycerol Stock
transglutaminase 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009374.1-2143s1c1
Sequence:CCGGCAGCAGCACTCCCACAGACGTCTCGAGACGTCTGTGGGAGTGCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009374.1-718s1c1
Sequence:CCGGGCCATGATTAATGGCAATGATCTCGAGATCATTGCCATTAATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009374.1-1162s1c1
Sequence:CCGGGCTTCCGTTAATGCAATCAAACTCGAGTTTGATTGCATTAACGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009374.1-256s1c1
Sequence:CCGGGCCAGGACAAAGGCTGTATTTCTCGAGAAATACAGCCTTTGTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009374.1-2081s1c1
Sequence:CCGGCCTGCAATAAATTCCCTACAACTCGAGTTGTAGGGAATTTATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009374.2-1987s21c1
Sequence:CCGGAGAAGTCCCGCATCCGATTTGCTCGAGCAAATCGGATGCGGGACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009374.2-1216s21c1
Sequence:CCGGATCGCATCACTTGGATCTATACTCGAGTATAGATCCAAGTGATGCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009374.2-406s21c1
Sequence:CCGGTGAAACTTGGCACGTTTATAACTCGAGTTATAAACGTGCCAAGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009374
TGM3 MISSION shRNA shRNA Plasmid DNA
transglutaminase 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009374.1-2143s1c1
Sequence:CCGGCAGCAGCACTCCCACAGACGTCTCGAGACGTCTGTGGGAGTGCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009374.1-718s1c1
Sequence:CCGGGCCATGATTAATGGCAATGATCTCGAGATCATTGCCATTAATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009374.1-1162s1c1
Sequence:CCGGGCTTCCGTTAATGCAATCAAACTCGAGTTTGATTGCATTAACGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009374.1-256s1c1
Sequence:CCGGGCCAGGACAAAGGCTGTATTTCTCGAGAAATACAGCCTTTGTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009374.1-2081s1c1
Sequence:CCGGCCTGCAATAAATTCCCTACAACTCGAGTTGTAGGGAATTTATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009374.2-1987s21c1
Sequence:CCGGAGAAGTCCCGCATCCGATTTGCTCGAGCAAATCGGATGCGGGACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009374.2-1216s21c1
Sequence:CCGGATCGCATCACTTGGATCTATACTCGAGTATAGATCCAAGTGATGCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009374.2-406s21c1
Sequence:CCGGTGAAACTTGGCACGTTTATAACTCGAGTTATAAACGTGCCAAGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009374
TGM3 MISSION shRNA Lentiviral Transduction Particles
transglutaminase 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009374.1-2143s1c1
Sequence:CCGGCAGCAGCACTCCCACAGACGTCTCGAGACGTCTGTGGGAGTGCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009374.1-718s1c1
Sequence:CCGGGCCATGATTAATGGCAATGATCTCGAGATCATTGCCATTAATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009374.1-1162s1c1
Sequence:CCGGGCTTCCGTTAATGCAATCAAACTCGAGTTTGATTGCATTAACGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009374.1-256s1c1
Sequence:CCGGGCCAGGACAAAGGCTGTATTTCTCGAGAAATACAGCCTTTGTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009374.1-2081s1c1
Sequence:CCGGCCTGCAATAAATTCCCTACAACTCGAGTTGTAGGGAATTTATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009374.2-1987s21c1
Sequence:CCGGAGAAGTCCCGCATCCGATTTGCTCGAGCAAATCGGATGCGGGACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009374.2-1216s21c1
Sequence:CCGGATCGCATCACTTGGATCTATACTCGAGTATAGATCCAAGTGATGCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009374.2-406s21c1
Sequence:CCGGTGAAACTTGGCACGTTTATAACTCGAGTTATAAACGTGCCAAGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks