EMAIL THIS PAGE TO A FRIEND

TGM4

transglutaminase 4

Synonyms: TGP hTGP
Species: Human TGM4(7047), Mouse Tgm4(331046), Rat Tgm4(64679), naked mole-rat Tgm4(101722232), domestic guinea pig Tgm4(100716396), chicken TGM4(420706)
UniProtKB ID: P49221, Q16707, Q96QN4
Gene ID:
Mouse(331046) transglutaminase 4 (prostate)
Rat(64679) transglutaminase 4 (prostate)
naked mole-rat(101722232) transglutaminase 4
domestic guinea pig(100716396) transglutaminase 4
chicken(420706) transglutaminase 4 (prostate)
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Activity Assay

Product # Description Species Add to Cart
 
CS1070 Transglutaminase Assay Kit sufficient for assays in two 96-well plates human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177911 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177911 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177911 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003241 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003241 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003241 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003241 Rosetta Predictions human pricing
NM_022713 Rosetta Predictions rat pricing
XM_579463 Rosetta Predictions rat pricing
NM_177911 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003241 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025587 predicted 1869
2 SASI_Hs01_00025588 predicted 1211
3 SASI_Hs01_00025589 predicted 1747
4 SASI_Hs01_00025590 predicted 1019
5 SASI_Hs01_00025591 predicted 1802
6 SASI_Hs01_00025592 predicted 1788
7 SASI_Hs01_00025593 predicted 1716
8 SASI_Hs01_00025594 predicted 487
9 SASI_Hs01_00025595 predicted 1372
10 SASI_Hs01_00025596 predicted 2094
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022713 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263539 predicted 284
2 SASI_Rn02_00263540 predicted 1740
3 SASI_Rn02_00263541 predicted 677
4 SASI_Rn02_00263542 predicted 1317
5 SASI_Rn02_00263543 predicted 976
6 SASI_Rn02_00263544 predicted 219
7 SASI_Rn02_00263545 predicted 1125
8 SASI_Rn02_00263546 predicted 1608
9 SASI_Rn02_00263547 predicted 569
10 SASI_Rn02_00263548 predicted 409
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579463 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00139532 predicted 1998
2 SASI_Rn01_00139533 predicted 298
3 SASI_Rn01_00139534 predicted 696
4 SASI_Rn01_00139535 predicted 1951
5 SASI_Rn01_00139536 predicted 1335
6 SASI_Rn01_00139537 predicted 992
7 SASI_Rn01_00139538 predicted 239
8 SASI_Rn01_00139539 predicted 1143
9 SASI_Rn01_00139540 predicted 1625
10 SASI_Rn01_00139541 predicted 591
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177911 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159831 predicted 1423
2 SASI_Mm01_00159832 predicted 1951
3 SASI_Mm02_00348395 predicted 1141
4 SASI_Mm01_00159833 predicted 399
5 SASI_Mm01_00159834 predicted 1319
6 SASI_Mm01_00159835 predicted 273
7 SASI_Mm01_00159836 predicted 1472
8 SASI_Mm01_00159837 predicted 985
9 SASI_Mm01_00159838 predicted 1386
10 SASI_Mm01_00159840 predicted 2061
11 SASI_Mm01_00159839 predicted 316
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177911
TGM4 MISSION shRNA Bacterial Glycerol Stock
transglutaminase 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177911.4-344s21c1
Sequence:CCGGAGTCTGGCGTAGAGGTTATTCCTCGAGGAATAACCTCTACGCCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177911.4-2174s21c1
Sequence:CCGGTTCAGGTCAGGGATGGTTAAACTCGAGTTTAACCATCCCTGACCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104665    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177911.2-2384s1c1
Sequence:CCGGCCATGTACAGAGCCCAGATATCTCGAGATATCTGGGCTCTGTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177911.2-550s1c1
Sequence:CCGGCGCCAAACAAATTAAAGAGAACTCGAGTTCTCTTTAATTTGTTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177911.2-1758s1c1
Sequence:CCGGCCACTGATACAACCCTGTGTTCTCGAGAACACAGGGTTGTATCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177911.2-1916s1c1
Sequence:CCGGGCTAACATGAAATCCTGGGAACTCGAGTTCCCAGGATTTCATGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177911.2-421s1c1
Sequence:CCGGCGAGTATAAAGCTGGAGTATTCTCGAGAATACTCCAGCTTTATACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177911
TGM4 MISSION shRNA shRNA Plasmid DNA
transglutaminase 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177911.4-344s21c1
Sequence:CCGGAGTCTGGCGTAGAGGTTATTCCTCGAGGAATAACCTCTACGCCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177911.4-2174s21c1
Sequence:CCGGTTCAGGTCAGGGATGGTTAAACTCGAGTTTAACCATCCCTGACCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104665    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177911.2-2384s1c1
Sequence:CCGGCCATGTACAGAGCCCAGATATCTCGAGATATCTGGGCTCTGTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177911.2-550s1c1
Sequence:CCGGCGCCAAACAAATTAAAGAGAACTCGAGTTCTCTTTAATTTGTTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177911.2-1758s1c1
Sequence:CCGGCCACTGATACAACCCTGTGTTCTCGAGAACACAGGGTTGTATCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177911.2-1916s1c1
Sequence:CCGGGCTAACATGAAATCCTGGGAACTCGAGTTCCCAGGATTTCATGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177911.2-421s1c1
Sequence:CCGGCGAGTATAAAGCTGGAGTATTCTCGAGAATACTCCAGCTTTATACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177911
TGM4 MISSION shRNA Lentiviral Transduction Particles
transglutaminase 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177911.4-344s21c1
Sequence:CCGGAGTCTGGCGTAGAGGTTATTCCTCGAGGAATAACCTCTACGCCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177911.4-2174s21c1
Sequence:CCGGTTCAGGTCAGGGATGGTTAAACTCGAGTTTAACCATCCCTGACCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104665    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177911.2-2384s1c1
Sequence:CCGGCCATGTACAGAGCCCAGATATCTCGAGATATCTGGGCTCTGTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177911.2-550s1c1
Sequence:CCGGCGCCAAACAAATTAAAGAGAACTCGAGTTCTCTTTAATTTGTTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177911.2-1758s1c1
Sequence:CCGGCCACTGATACAACCCTGTGTTCTCGAGAACACAGGGTTGTATCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177911.2-1916s1c1
Sequence:CCGGGCTAACATGAAATCCTGGGAACTCGAGTTCCCAGGATTTCATGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177911.2-421s1c1
Sequence:CCGGCGAGTATAAAGCTGGAGTATTCTCGAGAATACTCCAGCTTTATACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003241
TGM4 MISSION shRNA Bacterial Glycerol Stock
transglutaminase 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003241.1-1774s1c1
Sequence:CCGGCCTCTGAAGTATTCACGTCTTCTCGAGAAGACGTGAATACTTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003241.1-555s1c1
Sequence:CCGGGCCAGAAGTATCAAATGCAAACTCGAGTTTGCATTTGATACTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003241.1-1493s1c1
Sequence:CCGGGCTGGGAAACTCTGTTAATTTCTCGAGAAATTAACAGAGTTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003241.1-380s1c1
Sequence:CCGGCCTGGGCAAGTACCAACTAAACTCGAGTTTAGTTGGTACTTGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003241.1-1718s1c1
Sequence:CCGGGCCAGTTATCAGAGGTTTCATCTCGAGATGAAACCTCTGATAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003241
TGM4 MISSION shRNA shRNA Plasmid DNA
transglutaminase 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003241.1-1774s1c1
Sequence:CCGGCCTCTGAAGTATTCACGTCTTCTCGAGAAGACGTGAATACTTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003241.1-555s1c1
Sequence:CCGGGCCAGAAGTATCAAATGCAAACTCGAGTTTGCATTTGATACTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003241.1-1493s1c1
Sequence:CCGGGCTGGGAAACTCTGTTAATTTCTCGAGAAATTAACAGAGTTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003241.1-380s1c1
Sequence:CCGGCCTGGGCAAGTACCAACTAAACTCGAGTTTAGTTGGTACTTGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003241.1-1718s1c1
Sequence:CCGGGCCAGTTATCAGAGGTTTCATCTCGAGATGAAACCTCTGATAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003241
TGM4 MISSION shRNA Lentiviral Transduction Particles
transglutaminase 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003241.1-1774s1c1
Sequence:CCGGCCTCTGAAGTATTCACGTCTTCTCGAGAAGACGTGAATACTTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003241.1-555s1c1
Sequence:CCGGGCCAGAAGTATCAAATGCAAACTCGAGTTTGCATTTGATACTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003241.1-1493s1c1
Sequence:CCGGGCTGGGAAACTCTGTTAATTTCTCGAGAAATTAACAGAGTTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003241.1-380s1c1
Sequence:CCGGCCTGGGCAAGTACCAACTAAACTCGAGTTTAGTTGGTACTTGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003241.1-1718s1c1
Sequence:CCGGGCCAGTTATCAGAGGTTTCATCTCGAGATGAAACCTCTGATAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks