EMAIL THIS PAGE TO A FRIEND

TGM5

transglutaminase 5

Synonyms: TGASE5 TGASEX TGM6 TGMX TGX
UniProtKB ID: O43548, O43549, Q0VF40, Q9UEZ4
Gene ID:
Human(9333) Summary: This gene encodes a member of the transglutaminase family. The encoded protein catalyzes formation of protein cross-links between glutamine and lysine residues, often resulting in stabilization of protein assemblies. This reaction is calcium dependent. Mutations in this gene have been associated with acral peeling skin syndrome. [provided by RefSeq, Oct 2009]
Mouse(74176) transglutaminase 5
Rat(691929) transglutaminase 5
domestic cat(101080797) transglutaminase 5
dog(487522) transglutaminase 5
cow(514767) transglutaminase 5
sheep(101109916) transglutaminase 5
naked mole-rat(101720615) transglutaminase 5
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Activity Assay

Product # Description Species Add to Cart
 
CS1070 Transglutaminase Assay Kit sufficient for assays in two 96-well plates human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004245 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004245 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004245 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028799 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028799 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028799 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004245 Rosetta Predictions human pricing
NM_201631 Rosetta Predictions human pricing
XM_001080153 Rosetta Predictions rat pricing
NM_028799 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004245 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192528 predicted 689
2 SASI_Hs01_00192529 predicted 1308
3 SASI_Hs01_00192530 predicted 1524
4 SASI_Hs01_00192531 predicted 695
5 SASI_Hs01_00192532 predicted 1082
6 SASI_Hs01_00192533 predicted 478
7 SASI_Hs01_00192534 predicted 730
8 SASI_Hs01_00192535 predicted 1667
9 SASI_Hs01_00192536 predicted 646
10 SASI_Hs01_00192537 predicted 1614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201631 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127285 predicted 935
2 SASI_Hs01_00127286 predicted 1554
3 SASI_Hs01_00127287 predicted 1772
4 SASI_Hs01_00127288 predicted 938
5 SASI_Hs01_00127289 predicted 1323
6 SASI_Hs01_00127290 predicted 726
7 SASI_Hs01_00127291 predicted 984
8 SASI_Hs01_00127292 predicted 1907
9 SASI_Hs01_00127293 predicted 888
10 SASI_Hs01_00127294 predicted 1858
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080153 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00366844 predicted 2214
2 SASI_Rn02_00366845 predicted 2184
3 SASI_Rn02_00366846 predicted 2162
4 SASI_Rn02_00366847 predicted 2127
5 SASI_Rn02_00366848 predicted 2155
6 SASI_Rn02_00366849 predicted 2211
7 SASI_Rn02_00366850 predicted 2218
8 SASI_Rn02_00366851 predicted 2132
9 SASI_Rn02_00366852 predicted 2163
10 SASI_Rn02_00366853 predicted 2216
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028799 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123273 predicted 1032
2 SASI_Mm01_00123274 predicted 1437
3 SASI_Mm01_00123275 predicted 573
4 SASI_Mm01_00123276 predicted 1704
5 SASI_Mm01_00123277 predicted 655
6 SASI_Mm01_00123278 predicted 1517
7 SASI_Mm01_00123279 predicted 325
8 SASI_Mm01_00123280 predicted 765
9 SASI_Mm01_00123281 predicted 1685
10 SASI_Mm02_00334406 predicted 793
11 SASI_Mm01_00123272 predicted 654
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004245
TGM5 MISSION shRNA Bacterial Glycerol Stock
transglutaminase 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004245.1-1665s1c1
Sequence:CCGGCCACTCTCCATACAGGTGATACTCGAGTATCACCTGTATGGAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004245.1-924s1c1
Sequence:CCGGCTGAACTATGACACGCCCTTTCTCGAGAAAGGGCGTGTCATAGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004245.1-300s1c1
Sequence:CCGGCCCTGGAACTATGGACAGTTTCTCGAGAAACTGTCCATAGTTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004245.1-1517s1c1
Sequence:CCGGCCAGTACCTGTCAACAGACAACTCGAGTTGTCTGTTGACAGGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004245.1-476s1c1
Sequence:CCGGCAATGGAAACTGGAGTGAGAACTCGAGTTCTCACTCCAGTTTCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004245.3-1617s21c1
Sequence:CCGGTATCCAAGCATCACGATTAATCTCGAGATTAATCGTGATGCTTGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004245.3-2161s21c1
Sequence:CCGGTATGCTAGGCACTCAACAAATCTCGAGATTTGTTGAGTGCCTAGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004245
TGM5 MISSION shRNA shRNA Plasmid DNA
transglutaminase 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004245.1-1665s1c1
Sequence:CCGGCCACTCTCCATACAGGTGATACTCGAGTATCACCTGTATGGAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004245.1-924s1c1
Sequence:CCGGCTGAACTATGACACGCCCTTTCTCGAGAAAGGGCGTGTCATAGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004245.1-300s1c1
Sequence:CCGGCCCTGGAACTATGGACAGTTTCTCGAGAAACTGTCCATAGTTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004245.1-1517s1c1
Sequence:CCGGCCAGTACCTGTCAACAGACAACTCGAGTTGTCTGTTGACAGGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004245.1-476s1c1
Sequence:CCGGCAATGGAAACTGGAGTGAGAACTCGAGTTCTCACTCCAGTTTCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004245.3-1617s21c1
Sequence:CCGGTATCCAAGCATCACGATTAATCTCGAGATTAATCGTGATGCTTGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004245.3-2161s21c1
Sequence:CCGGTATGCTAGGCACTCAACAAATCTCGAGATTTGTTGAGTGCCTAGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004245
TGM5 MISSION shRNA Lentiviral Transduction Particles
transglutaminase 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004245.1-1665s1c1
Sequence:CCGGCCACTCTCCATACAGGTGATACTCGAGTATCACCTGTATGGAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004245.1-924s1c1
Sequence:CCGGCTGAACTATGACACGCCCTTTCTCGAGAAAGGGCGTGTCATAGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004245.1-300s1c1
Sequence:CCGGCCCTGGAACTATGGACAGTTTCTCGAGAAACTGTCCATAGTTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004245.1-1517s1c1
Sequence:CCGGCCAGTACCTGTCAACAGACAACTCGAGTTGTCTGTTGACAGGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004245.1-476s1c1
Sequence:CCGGCAATGGAAACTGGAGTGAGAACTCGAGTTCTCACTCCAGTTTCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004245.3-1617s21c1
Sequence:CCGGTATCCAAGCATCACGATTAATCTCGAGATTAATCGTGATGCTTGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004245.3-2161s21c1
Sequence:CCGGTATGCTAGGCACTCAACAAATCTCGAGATTTGTTGAGTGCCTAGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028799
TGM5 MISSION shRNA Bacterial Glycerol Stock
transglutaminase 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104555    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028799.1-2322s1c1
Sequence:CCGGGCAAAGGACTTGGGTTCAATTCTCGAGAATTGAACCCAAGTCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028799.1-694s1c1
Sequence:CCGGGCTAGAGAAGAGCCTGAACTTCTCGAGAAGTTCAGGCTCTTCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028799.1-1427s1c1
Sequence:CCGGGAGAGCTACAAGTATGAAGAACTCGAGTTCTTCATACTTGTAGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028799.1-1958s1c1
Sequence:CCGGCCGGGCATCATGATTAATGTTCTCGAGAACATTAATCATGATGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028799.1-1700s1c1
Sequence:CCGGCCTCAGTTCAAGGATCTCAAACTCGAGTTTGAGATCCTTGAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028799
TGM5 MISSION shRNA shRNA Plasmid DNA
transglutaminase 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104555    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028799.1-2322s1c1
Sequence:CCGGGCAAAGGACTTGGGTTCAATTCTCGAGAATTGAACCCAAGTCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028799.1-694s1c1
Sequence:CCGGGCTAGAGAAGAGCCTGAACTTCTCGAGAAGTTCAGGCTCTTCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028799.1-1427s1c1
Sequence:CCGGGAGAGCTACAAGTATGAAGAACTCGAGTTCTTCATACTTGTAGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028799.1-1958s1c1
Sequence:CCGGCCGGGCATCATGATTAATGTTCTCGAGAACATTAATCATGATGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028799.1-1700s1c1
Sequence:CCGGCCTCAGTTCAAGGATCTCAAACTCGAGTTTGAGATCCTTGAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028799
TGM5 MISSION shRNA Lentiviral Transduction Particles
transglutaminase 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104555    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028799.1-2322s1c1
Sequence:CCGGGCAAAGGACTTGGGTTCAATTCTCGAGAATTGAACCCAAGTCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028799.1-694s1c1
Sequence:CCGGGCTAGAGAAGAGCCTGAACTTCTCGAGAAGTTCAGGCTCTTCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028799.1-1427s1c1
Sequence:CCGGGAGAGCTACAAGTATGAAGAACTCGAGTTCTTCATACTTGTAGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028799.1-1958s1c1
Sequence:CCGGCCGGGCATCATGATTAATGTTCTCGAGAACATTAATCATGATGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028799.1-1700s1c1
Sequence:CCGGCCTCAGTTCAAGGATCTCAAACTCGAGTTTGAGATCCTTGAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks