EMAIL THIS PAGE TO A FRIEND

TGM6

transglutaminase 6

Synonyms: SCA35 TG6 TGM3L TGY dJ734P14.3
UniProtKB ID: O95932, Q5JXU4, Q5JXU5, Q719M2, Q719M3, Q9Y4U8
Gene ID:
Human(343641) Summary: The protein encoded by this gene belongs to the transglutaminase superfamily. It catalyzes the cross-linking of proteins and the conjugation of polyamines to proteins. Mutations in this gene are associated with spinocerebellar ataxia type 35 (SCA35). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Mouse(241636) transglutaminase 6
Rat(296152) transglutaminase 6
chicken(771144) transglutaminase 6
domestic cat(101083506) transglutaminase 6
Horse(100067214) transglutaminase 6
dog(485807) transglutaminase 6
naked mole-rat(101722267) transglutaminase 6
Domestic Rabbit(100352243) transglutaminase 6
domestic guinea pig(100718521) transglutaminase 6
cow(536356) transglutaminase 6
sheep(101114043) transglutaminase 6
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Activity Assay

Product # Description Species Add to Cart
 
CS1070 Transglutaminase Assay Kit sufficient for assays in two 96-well plates human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198994 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198994 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198994 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177726 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177726 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177726 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU079821 MISSION® esiRNA esiRNA targeting mouse Tgm6 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198994 Rosetta Predictions human pricing
XM_001079039 Rosetta Predictions rat pricing
XM_230601 Rosetta Predictions rat pricing
NM_177726 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198994 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140037 predicted 1289
2 SASI_Hs01_00140039 predicted 1402
3 SASI_Hs01_00140040 predicted 1835
4 SASI_Hs01_00140041 predicted 1294
5 SASI_Hs01_00140042 predicted 718
6 SASI_Hs01_00140043 predicted 1744
7 SASI_Hs01_00140044 predicted 853
8 SASI_Hs02_00372507 predicted 1735
9 SASI_Hs01_00140045 predicted 1748
10 SASI_Hs01_00140046 predicted 1097
11 SASI_Hs01_00140038 predicted 1742
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079039 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00362972 predicted 631
2 SASI_Rn02_00362973 predicted 988
3 SASI_Rn02_00362974 predicted 865
4 SASI_Rn02_00362975 predicted 1001
5 SASI_Rn02_00362976 predicted 2168
6 SASI_Rn02_00362977 predicted 2143
7 SASI_Rn02_00362978 predicted 2263
8 SASI_Rn02_00362979 predicted 2226
9 SASI_Rn02_00362980 predicted 2183
10 SASI_Rn02_00362981 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_230601 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386372 predicted 632
2 SASI_Rn02_00386373 predicted 986
3 SASI_Rn02_00386374 predicted 865
4 SASI_Rn02_00386375 predicted 1008
5 SASI_Rn02_00386376 predicted 2166
6 SASI_Rn02_00386377 predicted 2147
7 SASI_Rn02_00386378 predicted 2261
8 SASI_Rn02_00386379 predicted 2233
9 SASI_Rn02_00386380 predicted 2187
10 SASI_Rn02_00386381 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177726 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037343 predicted 322
2 SASI_Mm01_00037344 predicted 870
3 SASI_Mm01_00037345 predicted 985
4 SASI_Mm02_00348090 predicted 2219
5 SASI_Mm01_00037346 predicted 1001
6 SASI_Mm01_00037347 predicted 718
7 SASI_Mm01_00037349 predicted 2066
8 SASI_Mm02_00348091 predicted 1870
9 SASI_Mm01_00037350 predicted 2238
10 SASI_Mm01_00037351 predicted 2165
11 SASI_Mm01_00037348 predicted 2037
12 SASI_Mm01_00037352 predicted 1384
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198994
TGM6 MISSION shRNA Bacterial Glycerol Stock
transglutaminase 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198994.2-1419s21c1
Sequence:CCGGTGTACAGCAAGGCGGTGAACACTCGAGTGTTCACCGCCTTGCTGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198994.2-1371s21c1
Sequence:CCGGTCACTGACCTCTACAAGTATCCTCGAGGATACTTGTAGAGGTCAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198994.2-1229s21c1
Sequence:CCGGTTCGTGTTTGCGGAGGTCAACCTCGAGGTTGACCTCCGCAAACACGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198994.2-979s21c1
Sequence:CCGGGAACCTGAGTGTGGACAAATACTCGAGTATTTGTCCACACTCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198994.1-1294s1c1
Sequence:CCGGGCGTGTATACTCAAACACGAACTCGAGTTCGTGTTTGAGTATACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198994.1-1853s1c1
Sequence:CCGGGTGGAGAAGGACATTACTCTACTCGAGTAGAGTAATGTCCTTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198994.1-557s1c1
Sequence:CCGGCGAGGCGTGGAGAAGCACATACTCGAGTATGTGCTTCTCCACGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198994.1-1729s1c1
Sequence:CCGGGCCGCAAGAAGAGAAGAGAATCTCGAGATTCTCTTCTCTTCTTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198994.1-447s1c1
Sequence:CCGGTGGGCGAGTTTGTTCTCCTTTCTCGAGAAAGGAGAACAAACTCGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198994
TGM6 MISSION shRNA shRNA Plasmid DNA
transglutaminase 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198994.2-1419s21c1
Sequence:CCGGTGTACAGCAAGGCGGTGAACACTCGAGTGTTCACCGCCTTGCTGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198994.2-1371s21c1
Sequence:CCGGTCACTGACCTCTACAAGTATCCTCGAGGATACTTGTAGAGGTCAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198994.2-1229s21c1
Sequence:CCGGTTCGTGTTTGCGGAGGTCAACCTCGAGGTTGACCTCCGCAAACACGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198994.2-979s21c1
Sequence:CCGGGAACCTGAGTGTGGACAAATACTCGAGTATTTGTCCACACTCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198994.1-1294s1c1
Sequence:CCGGGCGTGTATACTCAAACACGAACTCGAGTTCGTGTTTGAGTATACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198994.1-1853s1c1
Sequence:CCGGGTGGAGAAGGACATTACTCTACTCGAGTAGAGTAATGTCCTTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198994.1-557s1c1
Sequence:CCGGCGAGGCGTGGAGAAGCACATACTCGAGTATGTGCTTCTCCACGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198994.1-1729s1c1
Sequence:CCGGGCCGCAAGAAGAGAAGAGAATCTCGAGATTCTCTTCTCTTCTTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198994.1-447s1c1
Sequence:CCGGTGGGCGAGTTTGTTCTCCTTTCTCGAGAAAGGAGAACAAACTCGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198994
TGM6 MISSION shRNA Lentiviral Transduction Particles
transglutaminase 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198994.2-1419s21c1
Sequence:CCGGTGTACAGCAAGGCGGTGAACACTCGAGTGTTCACCGCCTTGCTGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198994.2-1371s21c1
Sequence:CCGGTCACTGACCTCTACAAGTATCCTCGAGGATACTTGTAGAGGTCAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198994.2-1229s21c1
Sequence:CCGGTTCGTGTTTGCGGAGGTCAACCTCGAGGTTGACCTCCGCAAACACGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198994.2-979s21c1
Sequence:CCGGGAACCTGAGTGTGGACAAATACTCGAGTATTTGTCCACACTCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198994.1-1294s1c1
Sequence:CCGGGCGTGTATACTCAAACACGAACTCGAGTTCGTGTTTGAGTATACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198994.1-1853s1c1
Sequence:CCGGGTGGAGAAGGACATTACTCTACTCGAGTAGAGTAATGTCCTTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198994.1-557s1c1
Sequence:CCGGCGAGGCGTGGAGAAGCACATACTCGAGTATGTGCTTCTCCACGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198994.1-1729s1c1
Sequence:CCGGGCCGCAAGAAGAGAAGAGAATCTCGAGATTCTCTTCTCTTCTTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198994.1-447s1c1
Sequence:CCGGTGGGCGAGTTTGTTCTCCTTTCTCGAGAAAGGAGAACAAACTCGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177726
TGM6 MISSION shRNA Bacterial Glycerol Stock
transglutaminase 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177726.2-994s1c1
Sequence:CCGGGCAATCTGAGTGTGGACAAATCTCGAGATTTGTCCACACTCAGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177726.2-468s1c1
Sequence:CCGGCAGTTTATTCTCCTGTTCAATCTCGAGATTGAACAGGAGAATAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177726.2-995s1c1
Sequence:CCGGCAATCTGAGTGTGGACAAATACTCGAGTATTTGTCCACACTCAGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177726.2-2073s1c1
Sequence:CCGGGCCTTGATTCAATTCAACATACTCGAGTATGTTGAATTGAATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110670    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177726.2-2956s1c1
Sequence:CCGGGCCATGAAGAATATGCCACTACTCGAGTAGTGGCATATTCTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177726
TGM6 MISSION shRNA shRNA Plasmid DNA
transglutaminase 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177726.2-994s1c1
Sequence:CCGGGCAATCTGAGTGTGGACAAATCTCGAGATTTGTCCACACTCAGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177726.2-468s1c1
Sequence:CCGGCAGTTTATTCTCCTGTTCAATCTCGAGATTGAACAGGAGAATAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177726.2-995s1c1
Sequence:CCGGCAATCTGAGTGTGGACAAATACTCGAGTATTTGTCCACACTCAGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177726.2-2073s1c1
Sequence:CCGGGCCTTGATTCAATTCAACATACTCGAGTATGTTGAATTGAATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110670    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177726.2-2956s1c1
Sequence:CCGGGCCATGAAGAATATGCCACTACTCGAGTAGTGGCATATTCTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177726
TGM6 MISSION shRNA Lentiviral Transduction Particles
transglutaminase 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177726.2-994s1c1
Sequence:CCGGGCAATCTGAGTGTGGACAAATCTCGAGATTTGTCCACACTCAGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177726.2-468s1c1
Sequence:CCGGCAGTTTATTCTCCTGTTCAATCTCGAGATTGAACAGGAGAATAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177726.2-995s1c1
Sequence:CCGGCAATCTGAGTGTGGACAAATACTCGAGTATTTGTCCACACTCAGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177726.2-2073s1c1
Sequence:CCGGGCCTTGATTCAATTCAACATACTCGAGTATGTTGAATTGAATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110670    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177726.2-2956s1c1
Sequence:CCGGGCCATGAAGAATATGCCACTACTCGAGTAGTGGCATATTCTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks