EMAIL THIS PAGE TO A FRIEND

TGM7

transglutaminase 7

Synonyms: TGMZ
UniProtKB ID: Q96PF1
Gene ID:
Human(116179) Summary: Transglutaminases (TGM; EC 2.3.2.13) are a family of structurally and functionally related enzymes that stabilize protein assemblies through the formation of gamma-glutamyl-epsilon lysine crosslinks. For additional background information on transglutaminases, see TGM1 (MIM 190195).[supplied by OMIM, Jul 2002]
Mouse(640543) transglutaminase 7
Rat(366173) transglutaminase 7
cow(538521) transglutaminase 7
sheep(101106629) transglutaminase 7
domestic guinea pig(100716478) transglutaminase 7
Domestic Rabbit(100358974) transglutaminase 7
naked mole-rat(101716908) transglutaminase 7
Horse(100630434) transglutaminase 7
domestic cat(101080542) transglutaminase 7
dog(487523) transglutaminase 7
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Activity Assay

Product # Description Species Add to Cart
 
CS1070 Transglutaminase Assay Kit sufficient for assays in two 96-well plates human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052955 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052955 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052955 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052955 Rosetta Predictions human pricing
XM_001003231 Rosetta Predictions mouse pricing
XM_001479973 Rosetta Predictions mouse pricing
XM_917550 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052955 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042132 predicted 851
2 SASI_Hs01_00042133 predicted 332
3 SASI_Hs01_00042134 predicted 268
4 SASI_Hs01_00042135 predicted 392
5 SASI_Hs02_00361756 predicted 561
6 SASI_Hs01_00042136 predicted 478
7 SASI_Hs01_00042137 predicted 398
8 SASI_Hs01_00042138 predicted 1250
9 SASI_Hs01_00042139 predicted 1378
10 SASI_Hs01_00042140 predicted 1719
11 SASI_Hs01_00042141 predicted 946
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003231 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00355779 predicted 269
2 SASI_Mm02_00355780 predicted 640
3 SASI_Mm02_00355781 predicted 386
4 SASI_Mm02_00355782 predicted 494
5 SASI_Mm02_00355783 predicted 500
6 SASI_Mm02_00355784 predicted 463
7 SASI_Mm02_00355785 predicted 1435
8 SASI_Mm02_00355786 predicted 1247
9 SASI_Mm02_00355787 predicted 959
10 SASI_Mm02_00355788 predicted 945
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479973 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00414068 predicted 271
2 SASI_Mm02_00414069 predicted 637
3 SASI_Mm02_00414070 predicted 491
4 SASI_Mm02_00414071 predicted 504
5 SASI_Mm02_00414072 predicted 466
6 SASI_Mm02_00414073 predicted 1442
7 SASI_Mm02_00414074 predicted 1250
8 SASI_Mm02_00414075 predicted 621
9 SASI_Mm02_00414076 predicted 966
10 SASI_Mm02_00414077 predicted 948
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_917550 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00224929 predicted 277
2 SASI_Mm01_00224930 predicted 651
3 SASI_Mm01_00224931 predicted 501
4 SASI_Mm01_00224932 predicted 506
5 SASI_Mm01_00224933 predicted 462
6 SASI_Mm01_00224934 predicted 1440
7 SASI_Mm01_00224935 predicted 1259
8 SASI_Mm01_00224936 predicted 2094
9 SASI_Mm01_00224937 predicted 972
10 SASI_Mm01_00224938 predicted 953
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052955
TGM7 MISSION shRNA Bacterial Glycerol Stock
transglutaminase 7
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052955.1-380s1c1
Sequence:CCGGCCAAGGTCACAGTGTGACTTACTCGAGTAAGTCACACTGTGACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052955.1-1714s1c1
Sequence:CCGGGCAATTACAGAAACAAGCTAACTCGAGTTAGCTTGTTTCTGTAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052955.1-494s1c1
Sequence:CCGGGCGAGATTATGGCTTTGTTTACTCGAGTAAACAAAGCCATAATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052955.1-974s1c1
Sequence:CCGGCGAGATGCTGTCAACTCAGAACTCGAGTTCTGAGTTGACAGCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052955.1-853s1c1
Sequence:CCGGCCTCTGTTATGTGCACCGTAACTCGAGTTACGGTGCACATAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052955
TGM7 MISSION shRNA shRNA Plasmid DNA
transglutaminase 7
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052955.1-380s1c1
Sequence:CCGGCCAAGGTCACAGTGTGACTTACTCGAGTAAGTCACACTGTGACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052955.1-1714s1c1
Sequence:CCGGGCAATTACAGAAACAAGCTAACTCGAGTTAGCTTGTTTCTGTAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052955.1-494s1c1
Sequence:CCGGGCGAGATTATGGCTTTGTTTACTCGAGTAAACAAAGCCATAATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052955.1-974s1c1
Sequence:CCGGCGAGATGCTGTCAACTCAGAACTCGAGTTCTGAGTTGACAGCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052955.1-853s1c1
Sequence:CCGGCCTCTGTTATGTGCACCGTAACTCGAGTTACGGTGCACATAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052955
TGM7 MISSION shRNA Lentiviral Transduction Particles
transglutaminase 7
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052955.1-380s1c1
Sequence:CCGGCCAAGGTCACAGTGTGACTTACTCGAGTAAGTCACACTGTGACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052955.1-1714s1c1
Sequence:CCGGGCAATTACAGAAACAAGCTAACTCGAGTTAGCTTGTTTCTGTAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052955.1-494s1c1
Sequence:CCGGGCGAGATTATGGCTTTGTTTACTCGAGTAAACAAAGCCATAATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052955.1-974s1c1
Sequence:CCGGCGAGATGCTGTCAACTCAGAACTCGAGTTCTGAGTTGACAGCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052955.1-853s1c1
Sequence:CCGGCCTCTGTTATGTGCACCGTAACTCGAGTTACGGTGCACATAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks