EMAIL THIS PAGE TO A FRIEND

TGOLN2

trans-golgi network protein 2

Synonyms: TGN38 TGN46 TGN48 TGN51 TTGN2
Gene ID:
Human(10618) Summary: This gene encodes a type I integral membrane protein that is localized to the trans-Golgi network, a major sorting station for secretory and membrane proteins. The encoded protein cycles between early endosomes and the trans-Golgi network, and may play a role in exocytic vesicle formation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
Mouse(22135) trans-golgi network protein 2
Rat(192152) trans-golgi network protein 2
chicken(426548) trans-golgi network protein 2
dog(475772) trans-golgi network protein 2
129 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006464 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006464 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006464 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009444 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009444 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009444 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU005471 MISSION® esiRNA esiRNA targeting human TGOLN2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006464 Rosetta Predictions human pricing
NM_138840 Rosetta Predictions rat pricing
NM_009444 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006464 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080765 predicted 1596
2 SASI_Hs01_00080766 predicted 1392
3 SASI_Hs02_00341621 predicted 1459
4 SASI_Hs01_00080768 predicted 1493
5 SASI_Hs01_00080769 predicted 1145
6 SASI_Hs01_00080770 predicted 907
7 SASI_Hs01_00080771 predicted 1658
8 SASI_Hs01_00080773 predicted 1367
9 SASI_Hs02_00341622 predicted 1492
10 SASI_Hs01_00080774 predicted 1635
11 SASI_Hs01_00080767 predicted 1219
12 SASI_Hs01_00080772 predicted 372
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138840 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116514 predicted 738
2 SASI_Rn01_00116515 predicted 703
3 SASI_Rn01_00116516 predicted 887
4 SASI_Rn01_00116517 predicted 842
5 SASI_Rn01_00116518 predicted 976
6 SASI_Rn01_00116519 predicted 570
7 SASI_Rn02_00268221 predicted 738
8 SASI_Rn01_00116520 predicted 692
9 SASI_Rn01_00116521 predicted 271
10 SASI_Rn01_00116522 predicted 751
11 SASI_Rn01_00116523 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009444 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176980 predicted 1005
2 SASI_Mm01_00176981 predicted 771
3 SASI_Mm01_00176982 predicted 300
4 SASI_Mm01_00176983 predicted 798
5 SASI_Mm01_00176984 predicted 595
6 SASI_Mm01_00176985 predicted 890
7 SASI_Mm01_00176986 predicted 606
8 SASI_Mm01_00176987 predicted 741
9 SASI_Mm01_00176988 predicted 516
10 SASI_Mm01_00176989 predicted 726
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006464
VALIDATED
TGOLN2 MISSION shRNA Bacterial Glycerol Stock
trans-golgi network protein 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000312451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006464.2-359s21c1
Sequence:CCGGGAAAGCGTCAAGCAAGAAGAACTCGAGTTCTTCTTGCTTGACGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312401    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_006464.2-6034s21c1
Sequence:CCGGCCAGACTTCATGTTTGATAAACTCGAGTTTATCAAACATGAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312400    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006464.2-1703s21c1
Sequence:CCGGCCTGCTGATTTGTTTCTAAATCTCGAGATTTAGAAACAAATCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006464.2-1504s21c1
Sequence:CCGGCAAGCGGAAGATCATTGCTTTCTCGAGAAAGCAATGATCTTCCGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006464.2-1353s1c1
Sequence:CCGGGTGAAGGGACACTTTCGGATTCTCGAGAATCCGAAAGTGTCCCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006464.2-1301s1c1
Sequence:CCGGCCGCCCAAAGAAGAGAAAGAACTCGAGTTCTTTCTCTTCTTTGGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006464.2-1478s1c1
Sequence:CCGGGCTGTCCTCTATATCGCTCATCTCGAGATGAGCGATATAGAGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158419    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006464.2-6034s1c1
Sequence:CCGGCCAGACTTCATGTTTGATAAACTCGAGTTTATCAAACATGAAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159517    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006464.2-1703s1c1
Sequence:CCGGCCTGCTGATTTGTTTCTAAATCTCGAGATTTAGAAACAAATCAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006464.2-359s1c1
Sequence:CCGGGAAAGCGTCAAGCAAGAAGAACTCGAGTTCTTCTTGCTTGACGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006464.2-1084s1c1
Sequence:CCGGCATCTCCAACCCTTCTGATAACTCGAGTTATCAGAAGGGTTGGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162325    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006464.2-1504s1c1
Sequence:CCGGCAAGCGGAAGATCATTGCTTTCTCGAGAAAGCAATGATCTTCCGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006464.2-1380s1c1
Sequence:CCGGGTAGCGAGAAGGATGACCTTTCTCGAGAAAGGTCATCCTTCTCGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006464
VALIDATED
TGOLN2 MISSION shRNA shRNA Plasmid DNA
trans-golgi network protein 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000312451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006464.2-359s21c1
Sequence:CCGGGAAAGCGTCAAGCAAGAAGAACTCGAGTTCTTCTTGCTTGACGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312401    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_006464.2-6034s21c1
Sequence:CCGGCCAGACTTCATGTTTGATAAACTCGAGTTTATCAAACATGAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312400    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006464.2-1703s21c1
Sequence:CCGGCCTGCTGATTTGTTTCTAAATCTCGAGATTTAGAAACAAATCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006464.2-1504s21c1
Sequence:CCGGCAAGCGGAAGATCATTGCTTTCTCGAGAAAGCAATGATCTTCCGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006464.2-1353s1c1
Sequence:CCGGGTGAAGGGACACTTTCGGATTCTCGAGAATCCGAAAGTGTCCCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006464.2-1301s1c1
Sequence:CCGGCCGCCCAAAGAAGAGAAAGAACTCGAGTTCTTTCTCTTCTTTGGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006464.2-1478s1c1
Sequence:CCGGGCTGTCCTCTATATCGCTCATCTCGAGATGAGCGATATAGAGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158419    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006464.2-6034s1c1
Sequence:CCGGCCAGACTTCATGTTTGATAAACTCGAGTTTATCAAACATGAAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159517    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006464.2-1703s1c1
Sequence:CCGGCCTGCTGATTTGTTTCTAAATCTCGAGATTTAGAAACAAATCAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006464.2-359s1c1
Sequence:CCGGGAAAGCGTCAAGCAAGAAGAACTCGAGTTCTTCTTGCTTGACGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006464.2-1084s1c1
Sequence:CCGGCATCTCCAACCCTTCTGATAACTCGAGTTATCAGAAGGGTTGGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162325    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006464.2-1504s1c1
Sequence:CCGGCAAGCGGAAGATCATTGCTTTCTCGAGAAAGCAATGATCTTCCGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006464.2-1380s1c1
Sequence:CCGGGTAGCGAGAAGGATGACCTTTCTCGAGAAAGGTCATCCTTCTCGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006464
VALIDATED
TGOLN2 MISSION shRNA Lentiviral Transduction Particles
trans-golgi network protein 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000312451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006464.2-359s21c1
Sequence:CCGGGAAAGCGTCAAGCAAGAAGAACTCGAGTTCTTCTTGCTTGACGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312401    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_006464.2-6034s21c1
Sequence:CCGGCCAGACTTCATGTTTGATAAACTCGAGTTTATCAAACATGAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312400    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006464.2-1703s21c1
Sequence:CCGGCCTGCTGATTTGTTTCTAAATCTCGAGATTTAGAAACAAATCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006464.2-1504s21c1
Sequence:CCGGCAAGCGGAAGATCATTGCTTTCTCGAGAAAGCAATGATCTTCCGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006464.2-1353s1c1
Sequence:CCGGGTGAAGGGACACTTTCGGATTCTCGAGAATCCGAAAGTGTCCCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006464.2-1301s1c1
Sequence:CCGGCCGCCCAAAGAAGAGAAAGAACTCGAGTTCTTTCTCTTCTTTGGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006464.2-1478s1c1
Sequence:CCGGGCTGTCCTCTATATCGCTCATCTCGAGATGAGCGATATAGAGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158419    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006464.2-6034s1c1
Sequence:CCGGCCAGACTTCATGTTTGATAAACTCGAGTTTATCAAACATGAAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159517    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006464.2-1703s1c1
Sequence:CCGGCCTGCTGATTTGTTTCTAAATCTCGAGATTTAGAAACAAATCAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006464.2-359s1c1
Sequence:CCGGGAAAGCGTCAAGCAAGAAGAACTCGAGTTCTTCTTGCTTGACGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006464.2-1084s1c1
Sequence:CCGGCATCTCCAACCCTTCTGATAACTCGAGTTATCAGAAGGGTTGGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162325    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006464.2-1504s1c1
Sequence:CCGGCAAGCGGAAGATCATTGCTTTCTCGAGAAAGCAATGATCTTCCGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006464.2-1380s1c1
Sequence:CCGGGTAGCGAGAAGGATGACCTTTCTCGAGAAAGGTCATCCTTCTCGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009444
TGOLN2 MISSION shRNA Bacterial Glycerol Stock
trans-golgi network protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009444.1-304s1c1
Sequence:CCGGCCGATCACAGTTTGGGTGATTCTCGAGAATCACCCAAACTGTGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009444.1-168s1c1
Sequence:CCGGCCTGAGTCTTCTAACCAGGTACTCGAGTACCTGGTTAGAAGACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009444.1-1013s1c1
Sequence:CCGGCCACAACAAACGGAAGATTATCTCGAGATAATCTTCCGTTTGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009444.1-998s1c1
Sequence:CCGGCCTCTATATTGCTTACCACAACTCGAGTTGTGGTAAGCAATATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009444.1-816s1c1
Sequence:CCGGCCACTTGAAGAAGAGAATGAACTCGAGTTCATTCTCTTCTTCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009444
TGOLN2 MISSION shRNA shRNA Plasmid DNA
trans-golgi network protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009444.1-304s1c1
Sequence:CCGGCCGATCACAGTTTGGGTGATTCTCGAGAATCACCCAAACTGTGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009444.1-168s1c1
Sequence:CCGGCCTGAGTCTTCTAACCAGGTACTCGAGTACCTGGTTAGAAGACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009444.1-1013s1c1
Sequence:CCGGCCACAACAAACGGAAGATTATCTCGAGATAATCTTCCGTTTGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009444.1-998s1c1
Sequence:CCGGCCTCTATATTGCTTACCACAACTCGAGTTGTGGTAAGCAATATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009444.1-816s1c1
Sequence:CCGGCCACTTGAAGAAGAGAATGAACTCGAGTTCATTCTCTTCTTCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009444
TGOLN2 MISSION shRNA Lentiviral Transduction Particles
trans-golgi network protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009444.1-304s1c1
Sequence:CCGGCCGATCACAGTTTGGGTGATTCTCGAGAATCACCCAAACTGTGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009444.1-168s1c1
Sequence:CCGGCCTGAGTCTTCTAACCAGGTACTCGAGTACCTGGTTAGAAGACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009444.1-1013s1c1
Sequence:CCGGCCACAACAAACGGAAGATTATCTCGAGATAATCTTCCGTTTGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009444.1-998s1c1
Sequence:CCGGCCTCTATATTGCTTACCACAACTCGAGTTGTGGTAAGCAATATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009444.1-816s1c1
Sequence:CCGGCCACTTGAAGAAGAGAATGAACTCGAGTTCATTCTCTTCTTCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks