EMAIL THIS PAGE TO A FRIEND

TGS1

trimethylguanosine synthase 1

Synonyms: NCOA6IP PIMT PIPMT
UniProtKB ID: Q96RS0, A6NJQ5, Q5GH23, Q8TDG9, Q96QU3, Q9H5V3
Gene ID:
Mouse(116940) trimethylguanosine synthase homolog (S. cerevisiae)
Rat(312947) trimethylguanosine synthase 1
naked mole-rat(101697527) trimethylguanosine synthase 1
domestic guinea pig(100713266) trimethylguanosine synthase 1
cow(511392) trimethylguanosine synthase 1
sheep(101115131) trimethylguanosine synthase 1
chicken(421126) trimethylguanosine synthase 1
dog(477885) trimethylguanosine synthase 1
Horse(100067973) trimethylguanosine synthase 1
domestic cat(101096378) trimethylguanosine synthase 1
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_054089 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_054089 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_054089 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024831 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024831 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024831 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024831 Rosetta Predictions human pricing
NM_001107904 Rosetta Predictions rat pricing
NM_054089 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024831 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159393 predicted 475
2 SASI_Hs01_00159394 predicted 1314
3 SASI_Hs01_00159395 predicted 1417
4 SASI_Hs01_00159396 predicted 2518
5 SASI_Hs02_00357396 predicted 1810
6 SASI_Hs01_00159397 predicted 2568
7 SASI_Hs01_00159398 predicted 1237
8 SASI_Hs01_00159399 predicted 2591
9 SASI_Hs01_00159400 predicted 1008
10 SASI_Hs01_00159401 predicted 1427
11 SASI_Hs01_00159402 predicted 2681
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107904 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233425 predicted 2314
2 SASI_Rn02_00233426 predicted 2438
3 SASI_Rn02_00233427 predicted 1298
4 SASI_Rn02_00233428 predicted 1000
5 SASI_Rn02_00233429 predicted 1095
6 SASI_Rn02_00233430 predicted 2782
7 SASI_Rn02_00233431 predicted 955
8 SASI_Rn02_00233432 predicted 1308
9 SASI_Rn02_00233433 predicted 1241
10 SASI_Rn02_00233434 predicted 1168
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054089 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338023 predicted 2281
2 SASI_Mm02_00338024 predicted 2240
3 SASI_Mm02_00338025 predicted 2702
4 SASI_Mm02_00338026 predicted 391
5 SASI_Mm02_00338027 predicted 1035
6 SASI_Mm01_00149766 predicted 2755
7 SASI_Mm02_00338028 predicted 219
8 SASI_Mm02_00338029 predicted 2487
9 SASI_Mm02_00338030 predicted 622
10 SASI_Mm01_00149768 predicted 1259
11 SASI_Mm01_00149765 predicted 321
12 SASI_Mm01_00149767 predicted 1167
13 SASI_Mm01_00149769 predicted 952
14 SASI_Mm01_00149770 predicted 1833
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054089
VALIDATED
TGS1 MISSION shRNA Bacterial Glycerol Stock
trimethylguanosine synthase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090623    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_054089.3-4157s1c1
Sequence:CCGGGCACTGTCTTTCCTTACAATACTCGAGTATTGTAAGGAAAGACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054089.3-2007s1c1
Sequence:CCGGCCACCTGAAATAGCTTCTGTTCTCGAGAACAGAAGCTATTTCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054089.3-976s1c1
Sequence:CCGGGCAGCCTGAAAGCAGATGTAACTCGAGTTACATCTGCTTTCAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_054089.3-1899s1c1
Sequence:CCGGCCAGAGAACTGTTCAACTGAACTCGAGTTCAGTTGAACAGTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054089.3-870s1c1
Sequence:CCGGGAACAATTTCAGTATTGGGAACTCGAGTTCCCAATACTGAAATTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_054089.4-2847s21c1
Sequence:CCGGTGAAGTGGTTTGAGATCTTTACTCGAGTAAAGATCTCAAACCACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054089.4-485s21c1
Sequence:CCGGATGCAAGAAATAAAGCTAAAGCTCGAGCTTTAGCTTTATTTCTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_054089.4-2692s21c1
Sequence:CCGGTCTGAAGCGGAAGTGTGATACCTCGAGGTATCACACTTCCGCTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_054089.4-968s21c1
Sequence:CCGGACACAGAAGTAGACCAGAATGCTCGAGCATTCTGGTCTACTTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054089.4-1223s21c1
Sequence:CCGGCCTGTAATGGAACACCCAAAGCTCGAGCTTTGGGTGTTCCATTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054089
VALIDATED
TGS1 MISSION shRNA shRNA Plasmid DNA
trimethylguanosine synthase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090623    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_054089.3-4157s1c1
Sequence:CCGGGCACTGTCTTTCCTTACAATACTCGAGTATTGTAAGGAAAGACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054089.3-2007s1c1
Sequence:CCGGCCACCTGAAATAGCTTCTGTTCTCGAGAACAGAAGCTATTTCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054089.3-976s1c1
Sequence:CCGGGCAGCCTGAAAGCAGATGTAACTCGAGTTACATCTGCTTTCAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_054089.3-1899s1c1
Sequence:CCGGCCAGAGAACTGTTCAACTGAACTCGAGTTCAGTTGAACAGTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054089.3-870s1c1
Sequence:CCGGGAACAATTTCAGTATTGGGAACTCGAGTTCCCAATACTGAAATTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_054089.4-2847s21c1
Sequence:CCGGTGAAGTGGTTTGAGATCTTTACTCGAGTAAAGATCTCAAACCACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054089.4-485s21c1
Sequence:CCGGATGCAAGAAATAAAGCTAAAGCTCGAGCTTTAGCTTTATTTCTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_054089.4-2692s21c1
Sequence:CCGGTCTGAAGCGGAAGTGTGATACCTCGAGGTATCACACTTCCGCTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_054089.4-968s21c1
Sequence:CCGGACACAGAAGTAGACCAGAATGCTCGAGCATTCTGGTCTACTTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054089.4-1223s21c1
Sequence:CCGGCCTGTAATGGAACACCCAAAGCTCGAGCTTTGGGTGTTCCATTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054089
VALIDATED
TGS1 MISSION shRNA Lentiviral Transduction Particles
trimethylguanosine synthase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090623    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_054089.3-4157s1c1
Sequence:CCGGGCACTGTCTTTCCTTACAATACTCGAGTATTGTAAGGAAAGACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054089.3-2007s1c1
Sequence:CCGGCCACCTGAAATAGCTTCTGTTCTCGAGAACAGAAGCTATTTCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054089.3-976s1c1
Sequence:CCGGGCAGCCTGAAAGCAGATGTAACTCGAGTTACATCTGCTTTCAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_054089.3-1899s1c1
Sequence:CCGGCCAGAGAACTGTTCAACTGAACTCGAGTTCAGTTGAACAGTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054089.3-870s1c1
Sequence:CCGGGAACAATTTCAGTATTGGGAACTCGAGTTCCCAATACTGAAATTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_054089.4-2847s21c1
Sequence:CCGGTGAAGTGGTTTGAGATCTTTACTCGAGTAAAGATCTCAAACCACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054089.4-485s21c1
Sequence:CCGGATGCAAGAAATAAAGCTAAAGCTCGAGCTTTAGCTTTATTTCTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_054089.4-2692s21c1
Sequence:CCGGTCTGAAGCGGAAGTGTGATACCTCGAGGTATCACACTTCCGCTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_054089.4-968s21c1
Sequence:CCGGACACAGAAGTAGACCAGAATGCTCGAGCATTCTGGTCTACTTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054089.4-1223s21c1
Sequence:CCGGCCTGTAATGGAACACCCAAAGCTCGAGCTTTGGGTGTTCCATTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024831
VALIDATED
TGS1 MISSION shRNA Bacterial Glycerol Stock
trimethylguanosine synthase 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024831.5-2659s1c1
Sequence:CCGGGCTCGCAATAATGCAGAAGTTCTCGAGAACTTCTGCATTATTGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_024831.5-1929s1c1
Sequence:CCGGGCGCAGACAAATAAAGATGAACTCGAGTTCATCTTTATTTGTCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_024831.5-2499s1c1
Sequence:CCGGCGAGAAGATTGCTGAACACATCTCGAGATGTGTTCAGCAATCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_024831.5-775s1c1
Sequence:CCGGCCACTTCAATTTGGTAGGATACTCGAGTATCCTACCAAATTGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024831.5-1478s1c1
Sequence:CCGGGCCAATTAGATTCCTGTACAACTCGAGTTGTACAGGAATCTAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024831.6-1755s21c1
Sequence:CCGGATATGGTGGAATCCCAAATTTCTCGAGAAATTTGGGATTCCACCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_024831.6-1780s21c1
Sequence:CCGGCATCGGCAGGTCAGGTATTTACTCGAGTAAATACCTGACCTGCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024831.6-1938s21c1
Sequence:CCGGATTCCTCACATGGGTTAATAACTCGAGTTATTAACCCATGTGAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303577    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_024831.6-3315s21c1
Sequence:CCGGGCACTGCCACACCGTACTAATCTCGAGATTAGTACGGTGTGGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024831.6-1101s21c1
Sequence:CCGGGCAACATTATAGTCAACTTTACTCGAGTAAAGTTGACTATAATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_024831.6-2409s21c1
Sequence:CCGGCGAGAAGATTGCTGAACACATCTCGAGATGTGTTCAGCAATCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_024831.6-1336s21c1
Sequence:CCGGATACTTGATGGAATTAGTAACCTCGAGGTTACTAATTCCATCAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024831
VALIDATED
TGS1 MISSION shRNA shRNA Plasmid DNA
trimethylguanosine synthase 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024831.5-2659s1c1
Sequence:CCGGGCTCGCAATAATGCAGAAGTTCTCGAGAACTTCTGCATTATTGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_024831.5-1929s1c1
Sequence:CCGGGCGCAGACAAATAAAGATGAACTCGAGTTCATCTTTATTTGTCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_024831.5-2499s1c1
Sequence:CCGGCGAGAAGATTGCTGAACACATCTCGAGATGTGTTCAGCAATCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_024831.5-775s1c1
Sequence:CCGGCCACTTCAATTTGGTAGGATACTCGAGTATCCTACCAAATTGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024831.5-1478s1c1
Sequence:CCGGGCCAATTAGATTCCTGTACAACTCGAGTTGTACAGGAATCTAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024831.6-1755s21c1
Sequence:CCGGATATGGTGGAATCCCAAATTTCTCGAGAAATTTGGGATTCCACCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_024831.6-1780s21c1
Sequence:CCGGCATCGGCAGGTCAGGTATTTACTCGAGTAAATACCTGACCTGCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024831.6-1938s21c1
Sequence:CCGGATTCCTCACATGGGTTAATAACTCGAGTTATTAACCCATGTGAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303577    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_024831.6-3315s21c1
Sequence:CCGGGCACTGCCACACCGTACTAATCTCGAGATTAGTACGGTGTGGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024831.6-1101s21c1
Sequence:CCGGGCAACATTATAGTCAACTTTACTCGAGTAAAGTTGACTATAATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_024831.6-2409s21c1
Sequence:CCGGCGAGAAGATTGCTGAACACATCTCGAGATGTGTTCAGCAATCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_024831.6-1336s21c1
Sequence:CCGGATACTTGATGGAATTAGTAACCTCGAGGTTACTAATTCCATCAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024831
VALIDATED
TGS1 MISSION shRNA Lentiviral Transduction Particles
trimethylguanosine synthase 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024831.5-2659s1c1
Sequence:CCGGGCTCGCAATAATGCAGAAGTTCTCGAGAACTTCTGCATTATTGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_024831.5-1929s1c1
Sequence:CCGGGCGCAGACAAATAAAGATGAACTCGAGTTCATCTTTATTTGTCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_024831.5-2499s1c1
Sequence:CCGGCGAGAAGATTGCTGAACACATCTCGAGATGTGTTCAGCAATCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_024831.5-775s1c1
Sequence:CCGGCCACTTCAATTTGGTAGGATACTCGAGTATCCTACCAAATTGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024831.5-1478s1c1
Sequence:CCGGGCCAATTAGATTCCTGTACAACTCGAGTTGTACAGGAATCTAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024831.6-1755s21c1
Sequence:CCGGATATGGTGGAATCCCAAATTTCTCGAGAAATTTGGGATTCCACCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_024831.6-1780s21c1
Sequence:CCGGCATCGGCAGGTCAGGTATTTACTCGAGTAAATACCTGACCTGCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024831.6-1938s21c1
Sequence:CCGGATTCCTCACATGGGTTAATAACTCGAGTTATTAACCCATGTGAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303577    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_024831.6-3315s21c1
Sequence:CCGGGCACTGCCACACCGTACTAATCTCGAGATTAGTACGGTGTGGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024831.6-1101s21c1
Sequence:CCGGGCAACATTATAGTCAACTTTACTCGAGTAAAGTTGACTATAATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_024831.6-2409s21c1
Sequence:CCGGCGAGAAGATTGCTGAACACATCTCGAGATGTGTTCAGCAATCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_024831.6-1336s21c1
Sequence:CCGGATACTTGATGGAATTAGTAACCTCGAGGTTACTAATTCCATCAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks