EMAIL THIS PAGE TO A FRIEND

TH

tyrosine hydroxylase

Synonyms: DYT14 DYT5b TYH
UniProtKB ID: P07101, B7ZL70, Q15585, Q15588, Q15589
Gene ID:
Human(7054) Summary: The protein encoded by this gene is involved in the conversion of tyrosine to dopamine. It is the rate-limiting enzyme in the synthesis of catecholamines, hence plays a key role in the physiology of adrenergic neurons. Mutations in this gene have been associated with autosomal recessive Segawa syndrome. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jul 2008]
Mouse(21823) tyrosine hydroxylase
Rat(25085) tyrosine hydroxylase
cow(280707) tyrosine hydroxylase
sheep(101120619) tyrosine hydroxylase
domestic guinea pig(100734150) tyrosine hydroxylase
naked mole-rat(101721615) tyrosine hydroxylase
Domestic Rabbit(100009362) tyrosine hydroxylase
Zebrafish(30384) tyrosine hydroxylase
chicken(395592) tyrosine hydroxylase
dog(403444) tyrosine hydroxylase
domestic cat(101090720) tyrosine hydroxylase
Horse(100033842) tyrosine hydroxylase
107 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300257 Anti-phospho-Th (pSer19) antibody produced in rabbit affinity isolated antibody human, rat
immunofluorescence pricing
SAB4300170 Anti-phospho-TH (pSer40) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunofluorescence pricing
SAB4503787 Anti-phospho-Tyrosine Hydroxylase (pSer19) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4300674 Anti-phospho-Tyrosine Hydroxylase (pSer31) antibody produced in rabbit affinity isolated antibody human, mouse, rat
western blot pricing
SAB4503788 Anti-phospho-Tyrosine Hydroxylase (pSer31) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
T9573 Anti-phospho-Tyrosine Hydroxylase (pSer40) antibody produced in rabbit affinity isolated antibody, aqueous glycerol solution, sufficient for 10 blots mouse, rat, human
immunohistochemistry, western blot pricing
SAB4503789 Anti-phospho-Tyrosine Hydroxylase (pSer40) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4504005 Anti-phospho-Tyrosine Hydroxylase (pSer8) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4300675 Anti-Th (Ab-31) antibody produced in rabbit affinity isolated antibody mouse, rat
western blot pricing
SAB2501155 Anti-TH (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, human, canine
ELISA, western blot pricing
SAB2701683 Anti-th antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
HPA061003 Anti-TH antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse
immunohistochemistry, western blot pricing
SAB2103892 Anti-TH, (N-terminal) antibody produced in rabbit affinity isolated antibody rabbit, human, rat, rabbit, canine, zebrafish, mouse
western blot pricing
SAB2103911 Anti-TH, (N-terminal) antibody produced in rabbit affinity isolated antibody guinea pig, horse, rabbit, human
western blot pricing
T8700 Anti-Tyrosine Hydroxylase antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution, sufficient for 10 blots mammals
immunofluorescence, immunohistochemistry, western blot pricing
SAB4502964 Anti-Tyrosine Hydroxylase, N-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
SAB4502965 Anti-Tyrosine Hydroxylase, N-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunohistochemistry, western blot pricing
SAB4502966 Anti-Tyrosine Hydroxylase, N-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunohistochemistry, western blot pricing
SAB4502967 Anti-Tyrosine Hydroxylase, N-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse
immunohistochemistry, western blot pricing
AMAB91112 Monoclonal Anti-TH antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL3049, purified immunoglobulin, buffered aqueous glycerol solution mouse, human, rat
immunohistochemistry pricing
T2928 Monoclonal Anti-Tyrosine Hydroxylase antibody produced in mouse clone TH-16, ascites fluid rabbit, rat, guinea pig, bovine, sheep, human, monkey
immunohistochemistry, immunoprecipitation, microarray, western blot pricing
T1299 Monoclonal Anti-Tyrosine Hydroxylase antibody produced in mouse clone TH-2, ascites fluid human, monkey, rat, guinea pig, sheep, bovine, rabbit
immunohistochemistry, immunoprecipitation, western blot pricing

Small Molecule - Substrate

Product # Description Species Add to Cart
 
F4646 p-Fluoro-L-phenylalanine human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000360 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000360 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000360 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009377 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009377 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009377 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
AB152 Anti-Tyrosine Hydroxylase Antibody 100 µL, Anti-Tyrosine Hydroxylase Antibody detects level of TH and has been published and validated for use in ELISA, IF, IH, IH(P), IP and WB. pricing
AB1542 Anti-Tyrosine Hydroxylase Antibody 100 µL, Anti-Tyrosine Hydroxylase Antibody is an antibody against Tyrosine Hydroxylase for use in IH & WB. pricing
AB5986 Anti-Tyrosine Hydroxylase Antibody 50 µL, This Anti-Tyrosine Hydroxylase Antibody is validated for use in IH for the detection of Tyrosine Hydroxylase. pricing
AB5986P Anti-Tyrosine Hydroxylase Antibody 50 µg, Detect Tyrosine Hydroxylase using this Anti-Tyrosine Hydroxylase Antibody validated for use in IH. pricing
AB9702 Anti-Tyrosine Hydroxylase Antibody 500 µL, Anti-Tyrosine Hydroxylase Antibody is an antibody against Tyrosine Hydroxylase for use in IC, IH & WB. pricing
MABN1188 Anti-Tyrosine Hydroxylase Antibody, clone 10F8.2 100 µL, This Anti-Tyrosine Hydroxylase Antibody, clone 10F8.2 is validated for use in Western Blotting, Immunohistochemistry (Paraffin) for the detection of Tyrosine Hydroxylase. pricing
MAB5280 Anti-Tyrosine Hydroxylase Antibody, clone 2/40/15 40 µg, This Anti-Tyrosine Hydroxylase Antibody, clone 2/40/15 is validated for use in IH, WB for the detection of Tyrosine Hydroxylase. pricing
MAB5280X Anti-Tyrosine Hydroxylase Antibody, clone 2/40/15, Alexa Fluor® 488 100 µg, Anti-Tyrosine Hydroxylase Antibody, clone 2/40/15, Alexa Fluor 488 is an antibody against Tyrosine Hydroxylase for use in IH. pricing
MAB318 Anti-Tyrosine Hydroxylase Antibody, clone LNC1 100 µL, Detect Tyrosine Hydroxylase using this Anti-Tyrosine Hydroxylase Antibody, clone LNC1 validated for use in IH, IH(P), IP & WB with more than 85 product citations. pricing
MAB318-AF488 Anti-Tyrosine Hydroxylase Antibody, clone LNC1, Alexa Fluor® 488 Conjugate 100 µL, Anti-Tyrosine Hydroxylase Antibody, clone LNC1, Alexa Fluor® 488 Conjugate is an antibody against Tyrosine Hydroxylase for use in Immunocytochemistry. pricing
MAB318-AF555 Anti-Tyrosine Hydroxylase Antibody, clone LNC1, Alexa Fluor® 555 Conjugate 100 µL pricing
AB5935 Anti-Tyrosine Hydroxylase Antibody, phosphoSer 40 100 µL, Anti-Tyrosine Hydroxylase Antibody, phosphoSer 40 detects level of Tyrosine Hydroxylase & has been published & validated for use in IC, IH & WB. pricing
AB5423 Anti-Tyrosine Hydroxylase Antibody, phosphoSer31 100 µL, This Anti-Tyrosine Hydroxylase Antibody, phosphoSer31 is validated for use in IC, IH, WB for the detection of Tyrosine Hydroxylase. pricing
IHCR1005-6 Anti-Tyrosine Hydroxylase Antibody, prediluted, clone LNC1 6 mL, Anti-Tyrosine Hydroxylase Antibody, prediluted, clone LNC1 detects level of Tyrosine Hydroxylase & has been published & validated for use in IH(P). pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000360 Rosetta Predictions human pricing
NM_199292 Rosetta Predictions human pricing
NM_199293 Rosetta Predictions human pricing
NM_012740 Rosetta Predictions rat pricing
NM_009377 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000360 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200253 predicted 1295
2 SASI_Hs01_00200254 predicted 317
3 SASI_Hs01_00200255 predicted 1376
4 SASI_Hs01_00200257 predicted 1114
5 SASI_Hs01_00200258 predicted 1273
6 SASI_Hs01_00200259 predicted 1351
7 SASI_Hs01_00200260 predicted 947
8 SASI_Hs01_00200261 predicted 1105
9 SASI_Hs01_00200262 predicted 1282
10 SASI_Hs02_00302409 predicted 676
11 SASI_Hs01_00200256 predicted 634
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199292 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061850 predicted 1389
2 SASI_Hs01_00061851 predicted 406
3 SASI_Hs01_00061852 predicted 1469
4 SASI_Hs01_00061854 predicted 1211
5 SASI_Hs01_00061855 predicted 1372
6 SASI_Hs01_00061856 predicted 1441
7 SASI_Hs01_00061857 predicted 1040
8 SASI_Hs01_00061858 predicted 1193
9 SASI_Hs01_00061859 predicted 1381
10 SASI_Hs02_00372719 predicted 770
11 SASI_Hs01_00061853 predicted 729
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199293 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160473 predicted 1378
2 SASI_Hs01_00160474 predicted 397
3 SASI_Hs01_00160475 predicted 1465
4 SASI_Hs01_00160477 predicted 1194
5 SASI_Hs01_00160478 predicted 1356
6 SASI_Hs01_00160479 predicted 1431
7 SASI_Hs01_00160480 predicted 1028
8 SASI_Hs01_00160481 predicted 1189
9 SASI_Hs01_00160482 predicted 1364
10 SASI_Hs02_00372720 predicted 766
11 SASI_Hs01_00160476 predicted 719
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012740 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117106 predicted 1377
2 SASI_Rn01_00117107 predicted 523
3 SASI_Rn02_00260090 predicted 212
4 SASI_Rn01_00117108 predicted 1399
5 SASI_Rn01_00117109 predicted 1289
6 SASI_Rn01_00117110 predicted 824
7 SASI_Rn01_00117111 predicted 1021
8 SASI_Rn01_00117112 predicted 1343
9 SASI_Rn01_00117113 predicted 924
10 SASI_Rn01_00117114 predicted 1357
11 SASI_Rn01_00117105 predicted 1497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009377 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076282 predicted 1369
2 SASI_Mm02_00315987 predicted 1367
3 SASI_Mm01_00076283 predicted 673
4 SASI_Mm01_00076284 predicted 506
5 SASI_Mm01_00076285 predicted 304
6 SASI_Mm01_00076286 predicted 505
7 SASI_Mm01_00076287 predicted 1013
8 SASI_Mm01_00076288 predicted 1341
9 SASI_Mm01_00076289 predicted 625
10 SASI_Mm01_00076290 predicted 199
11 SASI_Mm01_00076291 predicted 924
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000360
TH MISSION shRNA Bacterial Glycerol Stock
tyrosine hydroxylase
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000360.3-1144s21c1
Sequence:CCGGGTTCGGGCTGTGTAAGCAGAACTCGAGTTCTGCTTACACAGCCCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000360.3-1110s21c1
Sequence:CCGGAGAAGCTGTCCACGCTGTACTCTCGAGAGTACAGCGTGGACAGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000360.2-317s1c1
Sequence:CCGGGTGAAGGTGTTTGAGACGTTTCTCGAGAAACGTCTCAAACACCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000360.2-1126s1c1
Sequence:CCGGGTCATGGTTCACGGTGGAGTTCTCGAGAACTCCACCGTGAACCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000360.2-697s1c1
Sequence:CCGGCGAGGAGATTGCCACCTGGAACTCGAGTTCCAGGTGGCAATCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000360.2-1294s1c1
Sequence:CCGGGACGTACCAGTCAGTCTACTTCTCGAGAAGTAGACTGACTGGTACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000360
TH MISSION shRNA shRNA Plasmid DNA
tyrosine hydroxylase
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000360.3-1144s21c1
Sequence:CCGGGTTCGGGCTGTGTAAGCAGAACTCGAGTTCTGCTTACACAGCCCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000360.3-1110s21c1
Sequence:CCGGAGAAGCTGTCCACGCTGTACTCTCGAGAGTACAGCGTGGACAGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000360.2-317s1c1
Sequence:CCGGGTGAAGGTGTTTGAGACGTTTCTCGAGAAACGTCTCAAACACCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000360.2-1126s1c1
Sequence:CCGGGTCATGGTTCACGGTGGAGTTCTCGAGAACTCCACCGTGAACCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000360.2-697s1c1
Sequence:CCGGCGAGGAGATTGCCACCTGGAACTCGAGTTCCAGGTGGCAATCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000360.2-1294s1c1
Sequence:CCGGGACGTACCAGTCAGTCTACTTCTCGAGAAGTAGACTGACTGGTACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000360
TH MISSION shRNA Lentiviral Transduction Particles
tyrosine hydroxylase
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000360.3-1144s21c1
Sequence:CCGGGTTCGGGCTGTGTAAGCAGAACTCGAGTTCTGCTTACACAGCCCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000360.3-1110s21c1
Sequence:CCGGAGAAGCTGTCCACGCTGTACTCTCGAGAGTACAGCGTGGACAGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000360.2-317s1c1
Sequence:CCGGGTGAAGGTGTTTGAGACGTTTCTCGAGAAACGTCTCAAACACCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000360.2-1126s1c1
Sequence:CCGGGTCATGGTTCACGGTGGAGTTCTCGAGAACTCCACCGTGAACCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000360.2-697s1c1
Sequence:CCGGCGAGGAGATTGCCACCTGGAACTCGAGTTCCAGGTGGCAATCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000360.2-1294s1c1
Sequence:CCGGGACGTACCAGTCAGTCTACTTCTCGAGAAGTAGACTGACTGGTACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009377
TH MISSION shRNA Bacterial Glycerol Stock
tyrosine hydroxylase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009377.1-1365s1c1
Sequence:CCGGCGCCCATTCTCTGTGAAGTTTCTCGAGAAACTTCACAGAGAATGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009377.1-1340s1c1
Sequence:CCGGCAGGAACTATGCCTCTCGTATCTCGAGATACGAGAGGCATAGTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009377.1-297s1c1
Sequence:CCGGTCTCGGGCTTTGAAAGTGTTTCTCGAGAAACACTTTCAAAGCCCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009377.1-675s1c1
Sequence:CCGGGAATACACAAAGGAGGAAATTCTCGAGAATTTCCTCCTTTGTGTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009377.1-117s1c1
Sequence:CCGGCGGCAGAGTCTCATCGAGGATCTCGAGATCCTCGATGAGACTCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009377
TH MISSION shRNA shRNA Plasmid DNA
tyrosine hydroxylase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009377.1-1365s1c1
Sequence:CCGGCGCCCATTCTCTGTGAAGTTTCTCGAGAAACTTCACAGAGAATGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009377.1-1340s1c1
Sequence:CCGGCAGGAACTATGCCTCTCGTATCTCGAGATACGAGAGGCATAGTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009377.1-297s1c1
Sequence:CCGGTCTCGGGCTTTGAAAGTGTTTCTCGAGAAACACTTTCAAAGCCCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009377.1-675s1c1
Sequence:CCGGGAATACACAAAGGAGGAAATTCTCGAGAATTTCCTCCTTTGTGTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009377.1-117s1c1
Sequence:CCGGCGGCAGAGTCTCATCGAGGATCTCGAGATCCTCGATGAGACTCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009377
TH MISSION shRNA Lentiviral Transduction Particles
tyrosine hydroxylase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009377.1-1365s1c1
Sequence:CCGGCGCCCATTCTCTGTGAAGTTTCTCGAGAAACTTCACAGAGAATGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009377.1-1340s1c1
Sequence:CCGGCAGGAACTATGCCTCTCGTATCTCGAGATACGAGAGGCATAGTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009377.1-297s1c1
Sequence:CCGGTCTCGGGCTTTGAAAGTGTTTCTCGAGAAACACTTTCAAAGCCCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009377.1-675s1c1
Sequence:CCGGGAATACACAAAGGAGGAAATTCTCGAGAATTTCCTCCTTTGTGTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009377.1-117s1c1
Sequence:CCGGCGGCAGAGTCTCATCGAGGATCTCGAGATCCTCGATGAGACTCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks