EMAIL THIS PAGE TO A FRIEND

THA1P

threonine aldolase 1, pseudogene

Synonyms: GLY1
Species: Human THA1P(390816)
Gene ID:
30 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372682 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372682 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372682 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001127683 Rosetta Predictions human pricing
XM_001132286 Rosetta Predictions human pricing
XM_001718558 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001127683 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00384125 predicted 823
2 SASI_Hs02_00384126 predicted 805
3 SASI_Hs02_00384127 predicted 881
4 SASI_Hs02_00384128 predicted 807
5 SASI_Hs02_00384129 predicted 804
6 SASI_Hs02_00384130 predicted 807
7 SASI_Hs02_00384131 predicted 840
8 SASI_Hs02_00384132 predicted 851
9 SASI_Hs02_00384133 predicted 848
10 SASI_Hs02_00384134 predicted 883
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001132286 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00389247 predicted 255
2 SASI_Hs02_00389248 predicted 736
3 SASI_Hs02_00389249 predicted 626
4 SASI_Hs02_00389250 predicted 887
5 SASI_Hs02_00389251 predicted 617
6 SASI_Hs02_00389252 predicted 633
7 SASI_Hs02_00389253 predicted 842
8 SASI_Hs02_00389254 predicted 652
9 SASI_Hs02_00389255 predicted 250
10 SASI_Hs02_00389256 predicted 579
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718558 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00424760 predicted 252
2 SASI_Hs02_00424761 predicted 732
3 SASI_Hs02_00424762 predicted 627
4 SASI_Hs02_00424763 predicted 881
5 SASI_Hs02_00424764 predicted 615
6 SASI_Hs02_00424765 predicted 630
7 SASI_Hs02_00424766 predicted 840
8 SASI_Hs02_00424767 predicted 649
9 SASI_Hs02_00424768 predicted 253
10 SASI_Hs02_00424769 predicted 575
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372682
THA1P MISSION shRNA Bacterial Glycerol Stock
threonine aldolase 1, pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372682.1-532s1c1
Sequence:CCGGCCCAAGGACTTCATTGAAGAACTCGAGTTCTTCAATGAAGTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372682.1-462s1c1
Sequence:CCGGGCACTGTGACTCTGTGTCTTTCTCGAGAAAGACACAGAGTCACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372682.1-670s1c1
Sequence:CCGGGCCCAGAGATTCACCCAAGGACTCGAGTCCTTGGGTGAATCTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372682.1-165s1c1
Sequence:CCGGCAACACTATGGCCAACCTCATCTCGAGATGAGGTTGGCCATAGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372682.1-98s1c1
Sequence:CCGGTCCGTGATGAGCTGCAAGAAACTCGAGTTTCTTGCAGCTCATCACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372682
THA1P MISSION shRNA shRNA Plasmid DNA
threonine aldolase 1, pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372682.1-532s1c1
Sequence:CCGGCCCAAGGACTTCATTGAAGAACTCGAGTTCTTCAATGAAGTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372682.1-462s1c1
Sequence:CCGGGCACTGTGACTCTGTGTCTTTCTCGAGAAAGACACAGAGTCACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372682.1-670s1c1
Sequence:CCGGGCCCAGAGATTCACCCAAGGACTCGAGTCCTTGGGTGAATCTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372682.1-165s1c1
Sequence:CCGGCAACACTATGGCCAACCTCATCTCGAGATGAGGTTGGCCATAGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372682.1-98s1c1
Sequence:CCGGTCCGTGATGAGCTGCAAGAAACTCGAGTTTCTTGCAGCTCATCACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372682
THA1P MISSION shRNA Lentiviral Transduction Particles
threonine aldolase 1, pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372682.1-532s1c1
Sequence:CCGGCCCAAGGACTTCATTGAAGAACTCGAGTTCTTCAATGAAGTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372682.1-462s1c1
Sequence:CCGGGCACTGTGACTCTGTGTCTTTCTCGAGAAAGACACAGAGTCACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372682.1-670s1c1
Sequence:CCGGGCCCAGAGATTCACCCAAGGACTCGAGTCCTTGGGTGAATCTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372682.1-165s1c1
Sequence:CCGGCAACACTATGGCCAACCTCATCTCGAGATGAGGTTGGCCATAGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372682.1-98s1c1
Sequence:CCGGTCCGTGATGAGCTGCAAGAAACTCGAGTTTCTTGCAGCTCATCACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks