EMAIL THIS PAGE TO A FRIEND

THADA

thyroid adenoma associated

Synonyms: GITA
Gene ID:
Mouse(240174) thyroid adenoma associated
Rat(313865) thyroid adenoma associated
Zebrafish(541356) thyroid adenoma associated
dog(100126180) thyroid adenoma associated
domestic cat(101093678) thyroid adenoma associated
chicken(421398) thyroid adenoma associated
cow(514187) thyroid adenoma associated
sheep(101114689) thyroid adenoma associated
naked mole-rat(101719083) thyroid adenoma associated
domestic guinea pig(100724767) thyroid adenoma associated
94 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183021 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183021 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183021 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022065 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022065 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022065 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_619495 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_619495 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_619495 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001083953 Rosetta Predictions human pricing
NM_022065 Rosetta Predictions human pricing
NM_198554 Rosetta Predictions human pricing
XM_001060686 Rosetta Predictions rat pricing
XM_233829 Rosetta Predictions rat pricing
XM_619495 Rosetta Predictions mouse pricing
XM_916970 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083953 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317351 predicted 2672
2 SASI_Hs02_00317352 predicted 3100
3 SASI_Hs02_00317353 predicted 5348
4 SASI_Hs02_00317354 predicted 1437
5 SASI_Hs02_00317355 predicted 3324
6 SASI_Hs02_00317356 predicted 936
7 SASI_Hs02_00317357 predicted 3466
8 SASI_Hs02_00317358 predicted 5273
9 SASI_Hs02_00317359 predicted 5631
10 SASI_Hs02_00317360 predicted 2131
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022065 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098777 predicted 2459
2 SASI_Hs01_00098778 predicted 2889
3 SASI_Hs02_00355430 predicted 5136
4 SASI_Hs01_00098780 predicted 1228
5 SASI_Hs01_00098781 predicted 3110
6 SASI_Hs01_00098783 predicted 726
7 SASI_Hs01_00098784 predicted 3253
8 SASI_Hs02_00355431 predicted 5058
9 SASI_Hs01_00098785 predicted 5426
10 SASI_Hs01_00098786 predicted 1918
11 SASI_Hs01_00098779 predicted 1806
12 SASI_Hs01_00098782 predicted 1757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198554 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013171 predicted 2444
2 SASI_Hs01_00013172 predicted 2879
3 SASI_Hs01_00013173 predicted 1518
4 SASI_Hs01_00013174 predicted 1785
5 SASI_Hs01_00013175 predicted 1808
6 SASI_Hs01_00013176 predicted 1216
7 SASI_Hs01_00013177 predicted 3501
8 SASI_Hs01_00013178 predicted 3106
9 SASI_Hs01_00013179 predicted 1750
10 SASI_Hs01_00013180 predicted 3247
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060686 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00297362 predicted 4711
2 SASI_Rn02_00297363 predicted 3321
3 SASI_Rn02_00297364 predicted 2859
4 SASI_Rn02_00297365 predicted 2781
5 SASI_Rn02_00297366 predicted 2873
6 SASI_Rn02_00297367 predicted 2108
7 SASI_Rn02_00297368 predicted 5364
8 SASI_Rn02_00297369 predicted 2088
9 SASI_Rn02_00297370 predicted 3983
10 SASI_Rn02_00297371 predicted 6538
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233829 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388070 predicted 4713
2 SASI_Rn02_00388071 predicted 3325
3 SASI_Rn02_00388072 predicted 2863
4 SASI_Rn02_00388073 predicted 2785
5 SASI_Rn02_00388074 predicted 2873
6 SASI_Rn02_00388075 predicted 2107
7 SASI_Rn02_00388076 predicted 5358
8 SASI_Rn02_00388077 predicted 2094
9 SASI_Rn02_00388078 predicted 3983
10 SASI_Rn02_00388079 predicted 6541
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_619495 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00263904 predicted 4367
2 SASI_Mm01_00263905 predicted 5033
3 SASI_Mm01_00263907 predicted 5036
4 SASI_Mm01_00263908 predicted 4413
5 SASI_Mm02_00427442 predicted 4508
6 SASI_Mm01_00263909 predicted 4488
7 SASI_Mm01_00263910 predicted 4689
8 SASI_Mm01_00263911 predicted 5656
9 SASI_Mm01_00263913 predicted 4651
10 SASI_Mm02_00427443 predicted 5048
11 SASI_Mm01_00263906 predicted 5949
12 SASI_Mm01_00263912 predicted 5734
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_916970 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00440738 predicted 3384
2 SASI_Mm02_00440739 predicted 878
3 SASI_Mm02_00440740 predicted 1176
4 SASI_Mm02_00440741 predicted 5667
5 SASI_Mm02_00440742 predicted 2497
6 SASI_Mm02_00440743 predicted 3458
7 SASI_Mm02_00440744 predicted 3371
8 SASI_Mm02_00440745 predicted 1918
9 SASI_Mm02_00440746 predicted 2889
10 SASI_Mm02_00440747 predicted 3843
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183021
THADA MISSION shRNA Bacterial Glycerol Stock
thyroid adenoma associated
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183021.1-562s1c1
Sequence:CCGGGACACAGAACAAATGCAGATTCTCGAGAATCTGCATTTGTTCTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183021.1-411s1c1
Sequence:CCGGCCCTTCATTATGATAGACCAACTCGAGTTGGTCTATCATAATGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183021.1-768s1c1
Sequence:CCGGGTGAGAAGAATTATCCTGGAACTCGAGTTCCAGGATAATTCTTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183021.2-4124s21c1
Sequence:CCGGGTGTGGTCGCTCACCTATTTACTCGAGTAAATAGGTGAGCGACCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183021.2-5578s21c1
Sequence:CCGGAGACTCTGACCTTCGTGAAATCTCGAGATTTCACGAAGGTCAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183021.2-2260s21c1
Sequence:CCGGTGTCGTCTGTTTGCAACATTCCTCGAGGAATGTTGCAAACAGACGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183021.2-1715s21c1
Sequence:CCGGGAGATCTTATGTGATTGATTACTCGAGTAATCAATCACATAAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183021.2-1939s21c1
Sequence:CCGGGGGTAAAGCAAGGCTTAATTCCTCGAGGAATTAAGCCTTGCTTTACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183021
THADA MISSION shRNA shRNA Plasmid DNA
thyroid adenoma associated
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183021.1-562s1c1
Sequence:CCGGGACACAGAACAAATGCAGATTCTCGAGAATCTGCATTTGTTCTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183021.1-411s1c1
Sequence:CCGGCCCTTCATTATGATAGACCAACTCGAGTTGGTCTATCATAATGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183021.1-768s1c1
Sequence:CCGGGTGAGAAGAATTATCCTGGAACTCGAGTTCCAGGATAATTCTTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183021.2-4124s21c1
Sequence:CCGGGTGTGGTCGCTCACCTATTTACTCGAGTAAATAGGTGAGCGACCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183021.2-5578s21c1
Sequence:CCGGAGACTCTGACCTTCGTGAAATCTCGAGATTTCACGAAGGTCAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183021.2-2260s21c1
Sequence:CCGGTGTCGTCTGTTTGCAACATTCCTCGAGGAATGTTGCAAACAGACGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183021.2-1715s21c1
Sequence:CCGGGAGATCTTATGTGATTGATTACTCGAGTAATCAATCACATAAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183021.2-1939s21c1
Sequence:CCGGGGGTAAAGCAAGGCTTAATTCCTCGAGGAATTAAGCCTTGCTTTACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183021
THADA MISSION shRNA Lentiviral Transduction Particles
thyroid adenoma associated
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183021.1-562s1c1
Sequence:CCGGGACACAGAACAAATGCAGATTCTCGAGAATCTGCATTTGTTCTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183021.1-411s1c1
Sequence:CCGGCCCTTCATTATGATAGACCAACTCGAGTTGGTCTATCATAATGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183021.1-768s1c1
Sequence:CCGGGTGAGAAGAATTATCCTGGAACTCGAGTTCCAGGATAATTCTTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183021.2-4124s21c1
Sequence:CCGGGTGTGGTCGCTCACCTATTTACTCGAGTAAATAGGTGAGCGACCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183021.2-5578s21c1
Sequence:CCGGAGACTCTGACCTTCGTGAAATCTCGAGATTTCACGAAGGTCAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183021.2-2260s21c1
Sequence:CCGGTGTCGTCTGTTTGCAACATTCCTCGAGGAATGTTGCAAACAGACGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183021.2-1715s21c1
Sequence:CCGGGAGATCTTATGTGATTGATTACTCGAGTAATCAATCACATAAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183021.2-1939s21c1
Sequence:CCGGGGGTAAAGCAAGGCTTAATTCCTCGAGGAATTAAGCCTTGCTTTACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022065
VALIDATED
THADA MISSION shRNA Bacterial Glycerol Stock
thyroid adenoma associated
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022065.3-2731s1c1
Sequence:CCGGGCCTACTTAACTCAGCAAGTTCTCGAGAACTTGCTGAGTTAAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022065.3-3749s1c1
Sequence:CCGGCCCAGGTTCATGCTTTAAATACTCGAGTATTTAAAGCATGAACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022065.3-5089s1c1
Sequence:CCGGGCTCTGAGACTTGCTTCCAAACTCGAGTTTGGAAGCAAGTCTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022065.3-1878s1c1
Sequence:CCGGCCCATCCTTAGGGTCTTGTAACTCGAGTTACAAGACCCTAAGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022065.3-4933s1c1
Sequence:CCGGCCAGAATGCTTCTGCAAGATACTCGAGTATCTTGCAGAAGCATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022065.4-5043s21c1
Sequence:CCGGTTGATCTGGACGATGGATATTCTCGAGAATATCCATCGTCCAGATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022065.4-433s21c1
Sequence:CCGGTATTGGCAAGCTCACTAAATACTCGAGTATTTAGTGAGCTTGCCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022065.4-1474s21c1
Sequence:CCGGTACGATTGGAATGGCATATTACTCGAGTAATATGCCATTCCAATCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022065.4-1929s21c1
Sequence:CCGGTTGATGGCATGTCTGCGAATACTCGAGTATTCGCAGACATGCCATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022065.4-887s21c1
Sequence:CCGGCACATCTGGATTAGCTATTATCTCGAGATAATAGCTAATCCAGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022065.4-4214s21c1
Sequence:CCGGTGTCTACCACTCCCGTGAAATCTCGAGATTTCACGGGAGTGGTAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022065.4-2046s21c1
Sequence:CCGGCAAGTAAGGATAGATACATTACTCGAGTAATGTATCTATCCTTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022065.4-284s21c1
Sequence:CCGGAGTGTCACAAATCCATTATATCTCGAGATATAATGGATTTGTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022065.4-3371s21c1
Sequence:CCGGAGAATCTTCTGATGGATTATTCTCGAGAATAATCCATCAGAAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022065.4-2014s21c1
Sequence:CCGGGAATAAAGCAAGGCTTAATTCCTCGAGGAATTAAGCCTTGCTTTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022065
VALIDATED
THADA MISSION shRNA shRNA Plasmid DNA
thyroid adenoma associated
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022065.3-2731s1c1
Sequence:CCGGGCCTACTTAACTCAGCAAGTTCTCGAGAACTTGCTGAGTTAAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022065.3-3749s1c1
Sequence:CCGGCCCAGGTTCATGCTTTAAATACTCGAGTATTTAAAGCATGAACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022065.3-5089s1c1
Sequence:CCGGGCTCTGAGACTTGCTTCCAAACTCGAGTTTGGAAGCAAGTCTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022065.3-1878s1c1
Sequence:CCGGCCCATCCTTAGGGTCTTGTAACTCGAGTTACAAGACCCTAAGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022065.3-4933s1c1
Sequence:CCGGCCAGAATGCTTCTGCAAGATACTCGAGTATCTTGCAGAAGCATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022065.4-5043s21c1
Sequence:CCGGTTGATCTGGACGATGGATATTCTCGAGAATATCCATCGTCCAGATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022065.4-433s21c1
Sequence:CCGGTATTGGCAAGCTCACTAAATACTCGAGTATTTAGTGAGCTTGCCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022065.4-1474s21c1
Sequence:CCGGTACGATTGGAATGGCATATTACTCGAGTAATATGCCATTCCAATCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022065.4-1929s21c1
Sequence:CCGGTTGATGGCATGTCTGCGAATACTCGAGTATTCGCAGACATGCCATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022065.4-887s21c1
Sequence:CCGGCACATCTGGATTAGCTATTATCTCGAGATAATAGCTAATCCAGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022065.4-4214s21c1
Sequence:CCGGTGTCTACCACTCCCGTGAAATCTCGAGATTTCACGGGAGTGGTAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022065.4-2046s21c1
Sequence:CCGGCAAGTAAGGATAGATACATTACTCGAGTAATGTATCTATCCTTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022065.4-284s21c1
Sequence:CCGGAGTGTCACAAATCCATTATATCTCGAGATATAATGGATTTGTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022065.4-3371s21c1
Sequence:CCGGAGAATCTTCTGATGGATTATTCTCGAGAATAATCCATCAGAAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022065.4-2014s21c1
Sequence:CCGGGAATAAAGCAAGGCTTAATTCCTCGAGGAATTAAGCCTTGCTTTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022065
VALIDATED
THADA MISSION shRNA Lentiviral Transduction Particles
thyroid adenoma associated
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022065.3-2731s1c1
Sequence:CCGGGCCTACTTAACTCAGCAAGTTCTCGAGAACTTGCTGAGTTAAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022065.3-3749s1c1
Sequence:CCGGCCCAGGTTCATGCTTTAAATACTCGAGTATTTAAAGCATGAACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022065.3-5089s1c1
Sequence:CCGGGCTCTGAGACTTGCTTCCAAACTCGAGTTTGGAAGCAAGTCTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022065.3-1878s1c1
Sequence:CCGGCCCATCCTTAGGGTCTTGTAACTCGAGTTACAAGACCCTAAGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022065.3-4933s1c1
Sequence:CCGGCCAGAATGCTTCTGCAAGATACTCGAGTATCTTGCAGAAGCATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022065.4-5043s21c1
Sequence:CCGGTTGATCTGGACGATGGATATTCTCGAGAATATCCATCGTCCAGATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022065.4-433s21c1
Sequence:CCGGTATTGGCAAGCTCACTAAATACTCGAGTATTTAGTGAGCTTGCCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022065.4-1474s21c1
Sequence:CCGGTACGATTGGAATGGCATATTACTCGAGTAATATGCCATTCCAATCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022065.4-1929s21c1
Sequence:CCGGTTGATGGCATGTCTGCGAATACTCGAGTATTCGCAGACATGCCATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022065.4-887s21c1
Sequence:CCGGCACATCTGGATTAGCTATTATCTCGAGATAATAGCTAATCCAGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022065.4-4214s21c1
Sequence:CCGGTGTCTACCACTCCCGTGAAATCTCGAGATTTCACGGGAGTGGTAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022065.4-2046s21c1
Sequence:CCGGCAAGTAAGGATAGATACATTACTCGAGTAATGTATCTATCCTTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022065.4-284s21c1
Sequence:CCGGAGTGTCACAAATCCATTATATCTCGAGATATAATGGATTTGTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022065.4-3371s21c1
Sequence:CCGGAGAATCTTCTGATGGATTATTCTCGAGAATAATCCATCAGAAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022065.4-2014s21c1
Sequence:CCGGGAATAAAGCAAGGCTTAATTCCTCGAGGAATTAAGCCTTGCTTTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_619495
THADA MISSION shRNA Bacterial Glycerol Stock
thyroid adenoma associated
Mouse
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000217718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_619495.4-2462s1c1
Sequence:CCGGGTATCAGCTGAGTCATGATATCTCGAGATATCATGACTCAGCTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_619495
THADA MISSION shRNA shRNA Plasmid DNA
thyroid adenoma associated
Mouse
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000217718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_619495.4-2462s1c1
Sequence:CCGGGTATCAGCTGAGTCATGATATCTCGAGATATCATGACTCAGCTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_619495
THADA MISSION shRNA Lentiviral Transduction Particles
thyroid adenoma associated
Mouse
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000217718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_619495.4-2462s1c1
Sequence:CCGGGTATCAGCTGAGTCATGATATCTCGAGATATCATGACTCAGCTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks