EMAIL THIS PAGE TO A FRIEND

THAP10

THAP domain containing 10

UniProtKB ID: Q9P2Z0, B2R8R0
Gene ID:
Human(56906) Summary: This gene encodes a member of a family of proteins sharing an N-terminal Thanatos-associated domain. The Thanatos-associated domain contains a zinc finger signature similar to DNA-binding domains. This gene is part of a bidirectional gene pair on the long arm of chromosome 15 that is regulated by estrogen and may play a role in breast cancer. [provided by RefSeq, Nov 2010]
dog(611157) THAP domain containing 10
domestic cat(101097486) THAP domain containing 10
cow(785266) THAP domain containing 10
sheep(101114781) THAP domain containing 10
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020147 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020147 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020147 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120551 MISSION® esiRNA esiRNA human THAP10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020147 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020147 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063886 predicted 832
2 SASI_Hs01_00063887 predicted 780
3 SASI_Hs01_00063888 predicted 718
4 SASI_Hs01_00063889 predicted 1341
5 SASI_Hs01_00063890 predicted 781
6 SASI_Hs02_00353038 predicted 883
7 SASI_Hs01_00063891 predicted 715
8 SASI_Hs02_00353039 predicted 562
9 SASI_Hs01_00063892 predicted 762
10 SASI_Hs01_00063893 predicted 655
11 SASI_Hs01_00063894 predicted 816
12 SASI_Hs01_00063895 predicted 856
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020147
VALIDATED
THAP10 MISSION shRNA Bacterial Glycerol Stock
THAP domain containing 10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020147.2-764s1c1
Sequence:CCGGGCAACTACTCAGACAGAGGAACTCGAGTTCCTCTGTCTGAGTAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020147.2-833s1c1
Sequence:CCGGGAAACAGATACAGACTGGGATCTCGAGATCCCAGTCTGTATCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_020147.2-777s1c1
Sequence:CCGGCAGAGGAATTGTGGTCTAGAACTCGAGTTCTAGACCACAATTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_020147.2-822s1c1
Sequence:CCGGCCAGTGATTCAGAAACAGATACTCGAGTATCTGTTTCTGAATCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020147.2-856s1c1
Sequence:CCGGCAAGAGTGAACAGAGTGATTTCTCGAGAAATCACTCTGTTCACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_020147.2-856s21c1
Sequence:CCGGCAAGAGTGAACAGAGTGATTTCTCGAGAAATCACTCTGTTCACTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_020147.2-777s21c1
Sequence:CCGGCAGAGGAATTGTGGTCTAGAACTCGAGTTCTAGACCACAATTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338527    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_020147.2-1343s21c1
Sequence:CCGGCCAAGCCTGACACTACTAAATCTCGAGATTTAGTAGTGTCAGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_020147.2-822s21c1
Sequence:CCGGCCAGTGATTCAGAAACAGATACTCGAGTATCTGTTTCTGAATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020147
VALIDATED
THAP10 MISSION shRNA shRNA Plasmid DNA
THAP domain containing 10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020147.2-764s1c1
Sequence:CCGGGCAACTACTCAGACAGAGGAACTCGAGTTCCTCTGTCTGAGTAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020147.2-833s1c1
Sequence:CCGGGAAACAGATACAGACTGGGATCTCGAGATCCCAGTCTGTATCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_020147.2-777s1c1
Sequence:CCGGCAGAGGAATTGTGGTCTAGAACTCGAGTTCTAGACCACAATTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_020147.2-822s1c1
Sequence:CCGGCCAGTGATTCAGAAACAGATACTCGAGTATCTGTTTCTGAATCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020147.2-856s1c1
Sequence:CCGGCAAGAGTGAACAGAGTGATTTCTCGAGAAATCACTCTGTTCACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_020147.2-856s21c1
Sequence:CCGGCAAGAGTGAACAGAGTGATTTCTCGAGAAATCACTCTGTTCACTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_020147.2-777s21c1
Sequence:CCGGCAGAGGAATTGTGGTCTAGAACTCGAGTTCTAGACCACAATTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338527    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_020147.2-1343s21c1
Sequence:CCGGCCAAGCCTGACACTACTAAATCTCGAGATTTAGTAGTGTCAGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_020147.2-822s21c1
Sequence:CCGGCCAGTGATTCAGAAACAGATACTCGAGTATCTGTTTCTGAATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020147
VALIDATED
THAP10 MISSION shRNA Lentiviral Transduction Particles
THAP domain containing 10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020147.2-764s1c1
Sequence:CCGGGCAACTACTCAGACAGAGGAACTCGAGTTCCTCTGTCTGAGTAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020147.2-833s1c1
Sequence:CCGGGAAACAGATACAGACTGGGATCTCGAGATCCCAGTCTGTATCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_020147.2-777s1c1
Sequence:CCGGCAGAGGAATTGTGGTCTAGAACTCGAGTTCTAGACCACAATTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_020147.2-822s1c1
Sequence:CCGGCCAGTGATTCAGAAACAGATACTCGAGTATCTGTTTCTGAATCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020147.2-856s1c1
Sequence:CCGGCAAGAGTGAACAGAGTGATTTCTCGAGAAATCACTCTGTTCACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_020147.2-856s21c1
Sequence:CCGGCAAGAGTGAACAGAGTGATTTCTCGAGAAATCACTCTGTTCACTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_020147.2-777s21c1
Sequence:CCGGCAGAGGAATTGTGGTCTAGAACTCGAGTTCTAGACCACAATTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338527    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_020147.2-1343s21c1
Sequence:CCGGCCAAGCCTGACACTACTAAATCTCGAGATTTAGTAGTGTCAGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_020147.2-822s21c1
Sequence:CCGGCCAGTGATTCAGAAACAGATACTCGAGTATCTGTTTCTGAATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks