EMAIL THIS PAGE TO A FRIEND

THAP11

THAP domain containing 11

Synonyms: CTG-B43a CTG-B45d RONIN
UniProtKB ID: Q96EK4, A4UCT5, A8K002, O94795
Gene ID:
Human(57215) Summary: The protein encoded by this gene contains a THAP domain, which is a conserved DNA-binding domain that has striking similarity to the site-specific DNA-binding domain (DBD) of Drosophila P element transposases. [provided by RefSeq, Jul 2008]
Mouse(59016) THAP domain containing 11
Rat(307806) THAP domain containing 11
cow(539845) THAP domain containing 11
sheep(101109824) THAP domain containing 11
naked mole-rat(101703693) THAP domain containing 11
domestic guinea pig(100731474) THAP domain containing 11
Zebrafish(406390) THAP domain containing 11
domestic cat(101081180) THAP domain containing 11
dog(489752) THAP domain containing 11
chicken(101749358) THAP domain containing 11
chicken(427530) THAP domain containing 11
109 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021513 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021513 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021513 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020457 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020457 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020457 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020457 Rosetta Predictions human pricing
NM_001107422 Rosetta Predictions rat pricing
NM_021513 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020457 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177060 predicted 1387
2 SASI_Hs01_00177062 predicted 948
3 SASI_Hs01_00177063 predicted 1499
4 SASI_Hs01_00177065 predicted 1113
5 SASI_Hs01_00177066 predicted 869
6 SASI_Hs01_00177067 predicted 1384
7 SASI_Hs01_00177068 predicted 1274
8 SASI_Hs01_00177069 predicted 1560
9 SASI_Hs02_00353502 predicted 1565
10 SASI_Hs02_00353503 predicted 1079
11 SASI_Hs01_00177061 predicted 1244
12 SASI_Hs01_00177064 predicted 1468
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107422 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228665 predicted 1447
2 SASI_Rn02_00228666 predicted 1340
3 SASI_Rn02_00228667 predicted 258
4 SASI_Rn02_00228668 predicted 1535
5 SASI_Rn02_00228669 predicted 1407
6 SASI_Rn02_00228670 predicted 907
7 SASI_Rn02_00228671 predicted 1510
8 SASI_Rn02_00228672 predicted 1477
9 SASI_Rn02_00228673 predicted 1193
10 SASI_Rn02_00228674 predicted 1241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021513 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326236 predicted 1275
2 SASI_Mm01_00076721 predicted 1531
3 SASI_Mm01_00076722 predicted 1327
4 SASI_Mm01_00076723 predicted 1534
5 SASI_Mm01_00076724 predicted 1434
6 SASI_Mm01_00076725 predicted 897
7 SASI_Mm01_00076726 predicted 1463
8 SASI_Mm01_00076727 predicted 1310
9 SASI_Mm01_00076728 predicted 1252
10 SASI_Mm01_00076730 predicted 1179
11 SASI_Mm01_00076729 predicted 1492
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021513
VALIDATED
THAP11 MISSION shRNA Bacterial Glycerol Stock
THAP domain containing 11
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021513.2-955s21c1
Sequence:CCGGTCTGACCACTCGTACTCCTTGCTCGAGCAAGGAGTACGAGTGGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021513.2-687s21c1
Sequence:CCGGCTCTGCAGCTGTGCTTCTTACCTCGAGGTAAGAAGCACAGCTGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021513.1-1487s21c1
Sequence:CCGGCCAGCAATCAGAGACAGCTTTCTCGAGAAAGCTGTCTCTGATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021513.1-1104s21c1
Sequence:CCGGCATGGCTGTCATCCGTAAGAACTCGAGTTCTTACGGATGACAGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021513.1-1068s21c1
Sequence:CCGGCCGTGAAGAACTTCGAGAGAACTCGAGTTCTCTCGAAGTTCTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021513.1-1068s1c1
Sequence:CCGGCCGTGAAGAACTTCGAGAGAACTCGAGTTCTCTCGAAGTTCTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021513.1-1104s1c1
Sequence:CCGGCATGGCTGTCATCCGTAAGAACTCGAGTTCTTACGGATGACAGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021513.1-1487s1c1
Sequence:CCGGCCAGCAATCAGAGACAGCTTTCTCGAGAAAGCTGTCTCTGATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021513.1-282s1c1
Sequence:CCGGGCACTTCTACACGTTTCCCAACTCGAGTTGGGAAACGTGTAGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021513.1-466s1c1
Sequence:CCGGCGTGGCGTCAATGAGCGCAAACTCGAGTTTGCGCTCATTGACGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021513
VALIDATED
THAP11 MISSION shRNA shRNA Plasmid DNA
THAP domain containing 11
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021513.2-955s21c1
Sequence:CCGGTCTGACCACTCGTACTCCTTGCTCGAGCAAGGAGTACGAGTGGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021513.2-687s21c1
Sequence:CCGGCTCTGCAGCTGTGCTTCTTACCTCGAGGTAAGAAGCACAGCTGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021513.1-1487s21c1
Sequence:CCGGCCAGCAATCAGAGACAGCTTTCTCGAGAAAGCTGTCTCTGATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021513.1-1104s21c1
Sequence:CCGGCATGGCTGTCATCCGTAAGAACTCGAGTTCTTACGGATGACAGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021513.1-1068s21c1
Sequence:CCGGCCGTGAAGAACTTCGAGAGAACTCGAGTTCTCTCGAAGTTCTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021513.1-1068s1c1
Sequence:CCGGCCGTGAAGAACTTCGAGAGAACTCGAGTTCTCTCGAAGTTCTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021513.1-1104s1c1
Sequence:CCGGCATGGCTGTCATCCGTAAGAACTCGAGTTCTTACGGATGACAGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021513.1-1487s1c1
Sequence:CCGGCCAGCAATCAGAGACAGCTTTCTCGAGAAAGCTGTCTCTGATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021513.1-282s1c1
Sequence:CCGGGCACTTCTACACGTTTCCCAACTCGAGTTGGGAAACGTGTAGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021513.1-466s1c1
Sequence:CCGGCGTGGCGTCAATGAGCGCAAACTCGAGTTTGCGCTCATTGACGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021513
VALIDATED
THAP11 MISSION shRNA Lentiviral Transduction Particles
THAP domain containing 11
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021513.2-955s21c1
Sequence:CCGGTCTGACCACTCGTACTCCTTGCTCGAGCAAGGAGTACGAGTGGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021513.2-687s21c1
Sequence:CCGGCTCTGCAGCTGTGCTTCTTACCTCGAGGTAAGAAGCACAGCTGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021513.1-1487s21c1
Sequence:CCGGCCAGCAATCAGAGACAGCTTTCTCGAGAAAGCTGTCTCTGATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021513.1-1104s21c1
Sequence:CCGGCATGGCTGTCATCCGTAAGAACTCGAGTTCTTACGGATGACAGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021513.1-1068s21c1
Sequence:CCGGCCGTGAAGAACTTCGAGAGAACTCGAGTTCTCTCGAAGTTCTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021513.1-1068s1c1
Sequence:CCGGCCGTGAAGAACTTCGAGAGAACTCGAGTTCTCTCGAAGTTCTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021513.1-1104s1c1
Sequence:CCGGCATGGCTGTCATCCGTAAGAACTCGAGTTCTTACGGATGACAGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021513.1-1487s1c1
Sequence:CCGGCCAGCAATCAGAGACAGCTTTCTCGAGAAAGCTGTCTCTGATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021513.1-282s1c1
Sequence:CCGGGCACTTCTACACGTTTCCCAACTCGAGTTGGGAAACGTGTAGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021513.1-466s1c1
Sequence:CCGGCGTGGCGTCAATGAGCGCAAACTCGAGTTTGCGCTCATTGACGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020457
THAP11 MISSION shRNA Bacterial Glycerol Stock
THAP domain containing 11
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164278    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020457.2-1384s1c1
Sequence:CCGGCCTGGTGACACCAGCAATTATCTCGAGATAATTGCTGGTGTCACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020457.2-1125s1c1
Sequence:CCGGGAAGAACTGCGTGAGAAGGATCTCGAGATCCTTCTCACGCAGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020457.2-1070s1c1
Sequence:CCGGGAAAGAGATGAAAGGCAGCATCTCGAGATGCTGCCTTTCATCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020457.2-1055s1c1
Sequence:CCGGGATGGAAGTGAAGATGAAAGACTCGAGTCTTTCATCTTCACTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020457.2-1062s1c1
Sequence:CCGGGTGAAGATGAAAGAGATGAAACTCGAGTTTCATCTCTTTCATCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163582    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020457.2-320s1c1
Sequence:CCGGGTTTCCAAAGGACGCTGAGTTCTCGAGAACTCAGCGTCCTTTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020457.2-308s1c1
Sequence:CCGGGCACTTCTACACGTTTCCAAACTCGAGTTTGGAAACGTGTAGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162329    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020457.2-1337s1c1
Sequence:CCGGCCTCAATTGTTTCCTCCTGAACTCGAGTTCAGGAGGAAACAATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020457.2-1050s1c1
Sequence:CCGGGCTCTGATGGAAGTGAAGATGCTCGAGCATCTTCACTTCCATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020457
THAP11 MISSION shRNA shRNA Plasmid DNA
THAP domain containing 11
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164278    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020457.2-1384s1c1
Sequence:CCGGCCTGGTGACACCAGCAATTATCTCGAGATAATTGCTGGTGTCACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020457.2-1125s1c1
Sequence:CCGGGAAGAACTGCGTGAGAAGGATCTCGAGATCCTTCTCACGCAGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020457.2-1070s1c1
Sequence:CCGGGAAAGAGATGAAAGGCAGCATCTCGAGATGCTGCCTTTCATCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020457.2-1055s1c1
Sequence:CCGGGATGGAAGTGAAGATGAAAGACTCGAGTCTTTCATCTTCACTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020457.2-1062s1c1
Sequence:CCGGGTGAAGATGAAAGAGATGAAACTCGAGTTTCATCTCTTTCATCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163582    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020457.2-320s1c1
Sequence:CCGGGTTTCCAAAGGACGCTGAGTTCTCGAGAACTCAGCGTCCTTTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020457.2-308s1c1
Sequence:CCGGGCACTTCTACACGTTTCCAAACTCGAGTTTGGAAACGTGTAGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162329    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020457.2-1337s1c1
Sequence:CCGGCCTCAATTGTTTCCTCCTGAACTCGAGTTCAGGAGGAAACAATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020457.2-1050s1c1
Sequence:CCGGGCTCTGATGGAAGTGAAGATGCTCGAGCATCTTCACTTCCATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020457
THAP11 MISSION shRNA Lentiviral Transduction Particles
THAP domain containing 11
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164278    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020457.2-1384s1c1
Sequence:CCGGCCTGGTGACACCAGCAATTATCTCGAGATAATTGCTGGTGTCACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020457.2-1125s1c1
Sequence:CCGGGAAGAACTGCGTGAGAAGGATCTCGAGATCCTTCTCACGCAGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020457.2-1070s1c1
Sequence:CCGGGAAAGAGATGAAAGGCAGCATCTCGAGATGCTGCCTTTCATCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020457.2-1055s1c1
Sequence:CCGGGATGGAAGTGAAGATGAAAGACTCGAGTCTTTCATCTTCACTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020457.2-1062s1c1
Sequence:CCGGGTGAAGATGAAAGAGATGAAACTCGAGTTTCATCTCTTTCATCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163582    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020457.2-320s1c1
Sequence:CCGGGTTTCCAAAGGACGCTGAGTTCTCGAGAACTCAGCGTCCTTTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020457.2-308s1c1
Sequence:CCGGGCACTTCTACACGTTTCCAAACTCGAGTTTGGAAACGTGTAGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162329    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020457.2-1337s1c1
Sequence:CCGGCCTCAATTGTTTCCTCCTGAACTCGAGTTCAGGAGGAAACAATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020457.2-1050s1c1
Sequence:CCGGGCTCTGATGGAAGTGAAGATGCTCGAGCATCTTCACTTCCATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks