EMAIL THIS PAGE TO A FRIEND

THAP1

THAP domain containing, apoptosis associated protein 1

Synonyms: DYT6
UniProtKB ID: Q9NVV9, A6NCB6, D3DSY5, H9KV49, Q53FQ1, Q6IA99
Gene ID:
Human(55145) Summary: The protein encoded by this gene contains a THAP domain, a conserved DNA-binding domain. This protein colocalizes with the apoptosis response protein PAWR/PAR-4 in promyelocytic leukemia (PML) nuclear bodies, and functions as a proapoptotic factor that links PAWR to PML nuclear bodies. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Mouse(73754) THAP domain containing, apoptosis associated protein 1
Rat(306547) THAP domain containing, apoptosis associated protein 1
domestic guinea pig(100719440) THAP domain containing, apoptosis associated protein 1
naked mole-rat(101703767) THAP domain containing, apoptosis associated protein 1
cow(538615) THAP domain containing, apoptosis associated protein 1
sheep(101119790) THAP domain containing, apoptosis associated protein 1
Zebrafish(692315) THAP domain containing, apoptosis associated protein 1
dog(475569) THAP domain containing, apoptosis associated protein 1
domestic cat(101097720) THAP domain containing, apoptosis associated protein 1
chicken(431620) THAP domain containing, apoptosis associated protein 1
168 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199042 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199042 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199042 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018105 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018105 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018105 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018105 Rosetta Predictions human pricing
NM_199003 Rosetta Predictions human pricing
NM_001008340 Rosetta Predictions rat pricing
NM_199042 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018105 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118946 predicted 748
2 SASI_Hs01_00118947 predicted 805
3 SASI_Hs02_00351292 predicted 855
4 SASI_Hs01_00118949 predicted 463
5 SASI_Hs01_00118951 predicted 934
6 SASI_Hs01_00118952 predicted 683
7 SASI_Hs02_00351293 predicted 799
8 SASI_Hs01_00118953 predicted 256
9 SASI_Hs01_00118954 predicted 452
10 SASI_Hs01_00118955 predicted 576
11 SASI_Hs01_00118948 predicted 315
12 SASI_Hs01_00118950 predicted 824
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199003 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229968 predicted 555
2 SASI_Hs01_00229969 predicted 606
3 SASI_Hs01_00229971 predicted 662
4 SASI_Hs01_00229972 predicted 627
5 SASI_Hs01_00229973 predicted 738
6 SASI_Hs01_00229974 predicted 491
7 SASI_Hs01_00229975 predicted 605
8 SASI_Hs01_00229976 predicted 258
9 SASI_Hs01_00229977 predicted 373
10 SASI_Hs02_00372519 predicted 480
11 SASI_Hs01_00229970 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008340 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115083 predicted 431
2 SASI_Rn01_00115084 predicted 304
3 SASI_Rn01_00115086 predicted 253
4 SASI_Rn01_00115087 predicted 399
5 SASI_Rn01_00115089 predicted 384
6 SASI_Rn01_00115090 predicted 660
7 SASI_Rn01_00115091 predicted 256
8 SASI_Rn01_00115092 predicted 441
9 SASI_Rn02_00199090 predicted 306
10 SASI_Rn02_00199091 predicted 234
11 SASI_Rn01_00115085 predicted 377
12 SASI_Rn01_00115088 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199042 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351324 predicted 1309
2 SASI_Mm01_00161761 predicted 477
3 SASI_Mm02_00351325 predicted 1113
4 SASI_Mm02_00351326 predicted 1408
5 SASI_Mm02_00351327 predicted 1315
6 SASI_Mm02_00351328 predicted 1312
7 SASI_Mm02_00351329 predicted 1257
8 SASI_Mm02_00351330 predicted 1269
9 SASI_Mm02_00351331 predicted 878
10 SASI_Mm01_00161767 predicted 462
11 SASI_Mm01_00161760 predicted 571
12 SASI_Mm01_00161762 predicted 467
13 SASI_Mm01_00161763 predicted 768
14 SASI_Mm01_00161764 predicted 776
15 SASI_Mm01_00161765 predicted 468
16 SASI_Mm01_00161766 predicted 569
17 SASI_Mm01_00161768 predicted 472
18 SASI_Mm01_00161769 predicted 637
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199042
VALIDATED
THAP1 MISSION shRNA Bacterial Glycerol Stock
THAP domain containing, apoptosis associated protein 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000175838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199042.1-848s1c1
Sequence:CCGGGAAATTGTTGAAGTTCCAGCACTCGAGTGCTGGAACTTCAACAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199042.1-500s1c1
Sequence:CCGGGAGAAGAAGGAAGACCTGGAACTCGAGTTCCAGGTCTTCCTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199042.1-823s1c1
Sequence:CCGGCGTGATCCTACCAAATGACTACTCGAGTAGTCATTTGGTAGGATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199042.1-829s1c1
Sequence:CCGGCCTACCAAATGACTACTTTGACTCGAGTCAAAGTAGTCATTTGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199042
VALIDATED
THAP1 MISSION shRNA shRNA Plasmid DNA
THAP domain containing, apoptosis associated protein 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000175838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199042.1-848s1c1
Sequence:CCGGGAAATTGTTGAAGTTCCAGCACTCGAGTGCTGGAACTTCAACAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199042.1-500s1c1
Sequence:CCGGGAGAAGAAGGAAGACCTGGAACTCGAGTTCCAGGTCTTCCTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199042.1-823s1c1
Sequence:CCGGCGTGATCCTACCAAATGACTACTCGAGTAGTCATTTGGTAGGATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199042.1-829s1c1
Sequence:CCGGCCTACCAAATGACTACTTTGACTCGAGTCAAAGTAGTCATTTGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199042
VALIDATED
THAP1 MISSION shRNA Lentiviral Transduction Particles
THAP domain containing, apoptosis associated protein 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000175838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199042.1-848s1c1
Sequence:CCGGGAAATTGTTGAAGTTCCAGCACTCGAGTGCTGGAACTTCAACAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199042.1-500s1c1
Sequence:CCGGGAGAAGAAGGAAGACCTGGAACTCGAGTTCCAGGTCTTCCTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199042.1-823s1c1
Sequence:CCGGCGTGATCCTACCAAATGACTACTCGAGTAGTCATTTGGTAGGATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199042.1-829s1c1
Sequence:CCGGCCTACCAAATGACTACTTTGACTCGAGTCAAAGTAGTCATTTGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018105
VALIDATED
THAP1 MISSION shRNA Bacterial Glycerol Stock
THAP domain containing, apoptosis associated protein 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121582    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018105.2-1862s1c1
Sequence:CCGGCCATTTAGTTAAATGCGTGATCTCGAGATCACGCATTTAACTAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018105.2-390s1c1
Sequence:CCGGCAGTATTTGTTCAGAGCACTTCTCGAGAAGTGCTCTGAACAAATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018105.2-688s1c1
Sequence:CCGGCAGCTAGAACAGCAAGTTGAACTCGAGTTCAACTTGCTGTTCTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143732    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018105.2-1722s1c1
Sequence:CCGGGCCTTCAAGTCTCTGACAAATCTCGAGATTTGTCAGAGACTTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018105.2-389s1c1
Sequence:CCGGGCAGTATTTGTTCAGAGCACTCTCGAGAGTGCTCTGAACAAATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018105.2-288s1c1
Sequence:CCGGCAAGCCCGTTTCTTTCCACAACTCGAGTTGTGGAAAGAAACGGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018105.2-405s1c1
Sequence:CCGGGCACTTTACTCCAGACTGCTTCTCGAGAAGCAGTCTGGAGTAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018105.2-574s1c1
Sequence:CCGGGATGCTGCTATTGGATTACTACTCGAGTAGTAATCCAATAGCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018105.2-811s1c1
Sequence:CCGGGACGTATCAGAAAGAGGTTATCTCGAGATAACCTCTTTCTGATACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144611    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018105.2-1745s1c1
Sequence:CCGGGCTGTGTTAGTAGAGTTTGATCTCGAGATCAAACTCTACTAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018105.2-934s1c1
Sequence:CCGGGCCTGTAAAGGAGTTTCATTTCTCGAGAAATGAAACTCCTTTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018105
VALIDATED
THAP1 MISSION shRNA shRNA Plasmid DNA
THAP domain containing, apoptosis associated protein 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121582    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018105.2-1862s1c1
Sequence:CCGGCCATTTAGTTAAATGCGTGATCTCGAGATCACGCATTTAACTAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018105.2-390s1c1
Sequence:CCGGCAGTATTTGTTCAGAGCACTTCTCGAGAAGTGCTCTGAACAAATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018105.2-688s1c1
Sequence:CCGGCAGCTAGAACAGCAAGTTGAACTCGAGTTCAACTTGCTGTTCTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143732    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018105.2-1722s1c1
Sequence:CCGGGCCTTCAAGTCTCTGACAAATCTCGAGATTTGTCAGAGACTTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018105.2-389s1c1
Sequence:CCGGGCAGTATTTGTTCAGAGCACTCTCGAGAGTGCTCTGAACAAATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018105.2-288s1c1
Sequence:CCGGCAAGCCCGTTTCTTTCCACAACTCGAGTTGTGGAAAGAAACGGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018105.2-405s1c1
Sequence:CCGGGCACTTTACTCCAGACTGCTTCTCGAGAAGCAGTCTGGAGTAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018105.2-574s1c1
Sequence:CCGGGATGCTGCTATTGGATTACTACTCGAGTAGTAATCCAATAGCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018105.2-811s1c1
Sequence:CCGGGACGTATCAGAAAGAGGTTATCTCGAGATAACCTCTTTCTGATACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144611    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018105.2-1745s1c1
Sequence:CCGGGCTGTGTTAGTAGAGTTTGATCTCGAGATCAAACTCTACTAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018105.2-934s1c1
Sequence:CCGGGCCTGTAAAGGAGTTTCATTTCTCGAGAAATGAAACTCCTTTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018105
VALIDATED
THAP1 MISSION shRNA Lentiviral Transduction Particles
THAP domain containing, apoptosis associated protein 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121582    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018105.2-1862s1c1
Sequence:CCGGCCATTTAGTTAAATGCGTGATCTCGAGATCACGCATTTAACTAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018105.2-390s1c1
Sequence:CCGGCAGTATTTGTTCAGAGCACTTCTCGAGAAGTGCTCTGAACAAATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018105.2-688s1c1
Sequence:CCGGCAGCTAGAACAGCAAGTTGAACTCGAGTTCAACTTGCTGTTCTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143732    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018105.2-1722s1c1
Sequence:CCGGGCCTTCAAGTCTCTGACAAATCTCGAGATTTGTCAGAGACTTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018105.2-389s1c1
Sequence:CCGGGCAGTATTTGTTCAGAGCACTCTCGAGAGTGCTCTGAACAAATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018105.2-288s1c1
Sequence:CCGGCAAGCCCGTTTCTTTCCACAACTCGAGTTGTGGAAAGAAACGGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018105.2-405s1c1
Sequence:CCGGGCACTTTACTCCAGACTGCTTCTCGAGAAGCAGTCTGGAGTAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018105.2-574s1c1
Sequence:CCGGGATGCTGCTATTGGATTACTACTCGAGTAGTAATCCAATAGCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018105.2-811s1c1
Sequence:CCGGGACGTATCAGAAAGAGGTTATCTCGAGATAACCTCTTTCTGATACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144611    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018105.2-1745s1c1
Sequence:CCGGGCTGTGTTAGTAGAGTTTGATCTCGAGATCAAACTCTACTAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018105.2-934s1c1
Sequence:CCGGGCCTGTAAAGGAGTTTCATTTCTCGAGAAATGAAACTCCTTTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks