EMAIL THIS PAGE TO A FRIEND

THAP2

THAP domain containing, apoptosis associated protein 2

UniProtKB ID: Q9H0W7, B2R8P3
Gene ID:
Mouse(66816) THAP domain containing, apoptosis associated protein 2
Rat(688019) THAP domain containing, apoptosis associated protein 2
domestic cat(101085299) THAP domain containing, apoptosis associated protein 2
dog(100683172) THAP domain containing, apoptosis associated protein 2
domestic guinea pig(100732602) THAP domain containing, apoptosis associated protein 2
naked mole-rat(101716817) THAP domain containing, apoptosis associated protein 2
cow(781850) THAP domain containing, apoptosis associated protein 2
sheep(101119806) THAP domain containing, apoptosis associated protein 2
109 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031435 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031435 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031435 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025780 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025780 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025780 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031435 Rosetta Predictions human pricing
XM_001080899 Rosetta Predictions rat pricing
NM_025780 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031435 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146206 predicted 1208
2 SASI_Hs01_00146207 predicted 1036
3 SASI_Hs02_00358846 predicted 1173
4 SASI_Hs01_00146208 predicted 844
5 SASI_Hs01_00146209 predicted 699
6 SASI_Hs01_00146210 predicted 767
7 SASI_Hs01_00146211 predicted 1116
8 SASI_Hs01_00146212 predicted 1144
9 SASI_Hs01_00146213 predicted 873
10 SASI_Hs01_00146214 predicted 534
11 SASI_Hs01_00146215 predicted 1071
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080899 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369760 predicted 328
2 SASI_Rn02_00369761 predicted 211
3 SASI_Rn02_00369762 predicted 275
4 SASI_Rn02_00369763 predicted 396
5 SASI_Rn02_00369764 predicted 487
6 SASI_Rn02_00369765 predicted 476
7 SASI_Rn02_00369766 predicted 398
8 SASI_Rn02_00369767 predicted 319
9 SASI_Rn02_00369768 predicted 394
10 SASI_Rn02_00369769 predicted 398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025780 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328998 predicted 1015
2 SASI_Mm02_00328999 predicted 350
3 SASI_Mm02_00329000 predicted 975
4 SASI_Mm02_00329001 predicted 1095
5 SASI_Mm02_00329002 predicted 324
6 SASI_Mm02_00329003 predicted 665
7 SASI_Mm02_00329004 predicted 506
8 SASI_Mm02_00329005 predicted 682
9 SASI_Mm02_00329006 predicted 1078
10 SASI_Mm02_00329007 predicted 418
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031435
VALIDATED
THAP2 MISSION shRNA Bacterial Glycerol Stock
THAP domain containing, apoptosis associated protein 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_031435.1-570s1c1
Sequence:CCGGCAGCTTCCACAGGTTTCCTTTCTCGAGAAAGGAAACCTGTGGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031435.1-1174s1c1
Sequence:CCGGCAGACCAAGAGTACCTTCATTCTCGAGAATGAAGGTACTCTTGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_031435.1-885s1c1
Sequence:CCGGCTATGCCTTTAGGAATCCTATCTCGAGATAGGATTCCTAAAGGCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_031435.1-1176s1c1
Sequence:CCGGGACCAAGAGTACCTTCATTTACTCGAGTAAATGAAGGTACTCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_031435.1-1015s1c1
Sequence:CCGGGCCACGTGTTTGGTAAAGAATCTCGAGATTCTTTACCAAACACGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151357    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_031435.1-1741s1c1
Sequence:CCGGGCCTCTCTCATAAGAATGATTCTCGAGAATCATTCTTATGAGAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031435
VALIDATED
THAP2 MISSION shRNA shRNA Plasmid DNA
THAP domain containing, apoptosis associated protein 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_031435.1-570s1c1
Sequence:CCGGCAGCTTCCACAGGTTTCCTTTCTCGAGAAAGGAAACCTGTGGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031435.1-1174s1c1
Sequence:CCGGCAGACCAAGAGTACCTTCATTCTCGAGAATGAAGGTACTCTTGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_031435.1-885s1c1
Sequence:CCGGCTATGCCTTTAGGAATCCTATCTCGAGATAGGATTCCTAAAGGCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_031435.1-1176s1c1
Sequence:CCGGGACCAAGAGTACCTTCATTTACTCGAGTAAATGAAGGTACTCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_031435.1-1015s1c1
Sequence:CCGGGCCACGTGTTTGGTAAAGAATCTCGAGATTCTTTACCAAACACGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151357    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_031435.1-1741s1c1
Sequence:CCGGGCCTCTCTCATAAGAATGATTCTCGAGAATCATTCTTATGAGAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031435
VALIDATED
THAP2 MISSION shRNA Lentiviral Transduction Particles
THAP domain containing, apoptosis associated protein 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_031435.1-570s1c1
Sequence:CCGGCAGCTTCCACAGGTTTCCTTTCTCGAGAAAGGAAACCTGTGGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031435.1-1174s1c1
Sequence:CCGGCAGACCAAGAGTACCTTCATTCTCGAGAATGAAGGTACTCTTGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_031435.1-885s1c1
Sequence:CCGGCTATGCCTTTAGGAATCCTATCTCGAGATAGGATTCCTAAAGGCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_031435.1-1176s1c1
Sequence:CCGGGACCAAGAGTACCTTCATTTACTCGAGTAAATGAAGGTACTCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_031435.1-1015s1c1
Sequence:CCGGGCCACGTGTTTGGTAAAGAATCTCGAGATTCTTTACCAAACACGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151357    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_031435.1-1741s1c1
Sequence:CCGGGCCTCTCTCATAAGAATGATTCTCGAGAATCATTCTTATGAGAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025780
VALIDATED
THAP2 MISSION shRNA Bacterial Glycerol Stock
THAP domain containing, apoptosis associated protein 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011843    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025780.2-1147s1c1
Sequence:CCGGGCTGGGATATTACATTCTAAACTCGAGTTTAGAATGTAATATCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025780.2-521s1c1
Sequence:CCGGGCTTGAACACAGTTATGCCTTCTCGAGAAGGCATAACTGTGTTCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025780.2-642s1c1
Sequence:CCGGGCAACTCGAAGGTGGATCAAACTCGAGTTTGATCCACCTTCGAGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025780.2-745s1c1
Sequence:CCGGGCAATCTTCCTCTGGAAGATTCTCGAGAATCTTCCAGAGGAAGATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025780.2-411s1c1
Sequence:CCGGACCCATATAAAGTCTCTGAAACTCGAGTTTCAGAGACTTTATATGGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025780.3-744s21c1
Sequence:CCGGGCAATCTTCCTCTGGAAGATTCTCGAGAATCTTCCAGAGGAAGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280214    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025780.3-1146s21c1
Sequence:CCGGGCTGGGATATTACATTCTAAACTCGAGTTTAGAATGTAATATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025780.3-410s21c1
Sequence:CCGGACCCATATAAAGTCTCTGAAACTCGAGTTTCAGAGACTTTATATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025780.3-356s21c1
Sequence:CCGGGGACAAACCCGACGACTTAAACTCGAGTTTAAGTCGTCGGGTTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025780.3-641s21c1
Sequence:CCGGGCAACTCGAAGGTGGATCAAACTCGAGTTTGATCCACCTTCGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025780
VALIDATED
THAP2 MISSION shRNA shRNA Plasmid DNA
THAP domain containing, apoptosis associated protein 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011843    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025780.2-1147s1c1
Sequence:CCGGGCTGGGATATTACATTCTAAACTCGAGTTTAGAATGTAATATCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025780.2-521s1c1
Sequence:CCGGGCTTGAACACAGTTATGCCTTCTCGAGAAGGCATAACTGTGTTCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025780.2-642s1c1
Sequence:CCGGGCAACTCGAAGGTGGATCAAACTCGAGTTTGATCCACCTTCGAGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025780.2-745s1c1
Sequence:CCGGGCAATCTTCCTCTGGAAGATTCTCGAGAATCTTCCAGAGGAAGATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025780.2-411s1c1
Sequence:CCGGACCCATATAAAGTCTCTGAAACTCGAGTTTCAGAGACTTTATATGGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025780.3-744s21c1
Sequence:CCGGGCAATCTTCCTCTGGAAGATTCTCGAGAATCTTCCAGAGGAAGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280214    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025780.3-1146s21c1
Sequence:CCGGGCTGGGATATTACATTCTAAACTCGAGTTTAGAATGTAATATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025780.3-410s21c1
Sequence:CCGGACCCATATAAAGTCTCTGAAACTCGAGTTTCAGAGACTTTATATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025780.3-356s21c1
Sequence:CCGGGGACAAACCCGACGACTTAAACTCGAGTTTAAGTCGTCGGGTTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025780.3-641s21c1
Sequence:CCGGGCAACTCGAAGGTGGATCAAACTCGAGTTTGATCCACCTTCGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025780
VALIDATED
THAP2 MISSION shRNA Lentiviral Transduction Particles
THAP domain containing, apoptosis associated protein 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011843    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025780.2-1147s1c1
Sequence:CCGGGCTGGGATATTACATTCTAAACTCGAGTTTAGAATGTAATATCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025780.2-521s1c1
Sequence:CCGGGCTTGAACACAGTTATGCCTTCTCGAGAAGGCATAACTGTGTTCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025780.2-642s1c1
Sequence:CCGGGCAACTCGAAGGTGGATCAAACTCGAGTTTGATCCACCTTCGAGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025780.2-745s1c1
Sequence:CCGGGCAATCTTCCTCTGGAAGATTCTCGAGAATCTTCCAGAGGAAGATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025780.2-411s1c1
Sequence:CCGGACCCATATAAAGTCTCTGAAACTCGAGTTTCAGAGACTTTATATGGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025780.3-744s21c1
Sequence:CCGGGCAATCTTCCTCTGGAAGATTCTCGAGAATCTTCCAGAGGAAGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280214    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025780.3-1146s21c1
Sequence:CCGGGCTGGGATATTACATTCTAAACTCGAGTTTAGAATGTAATATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025780.3-410s21c1
Sequence:CCGGACCCATATAAAGTCTCTGAAACTCGAGTTTCAGAGACTTTATATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025780.3-356s21c1
Sequence:CCGGGGACAAACCCGACGACTTAAACTCGAGTTTAAGTCGTCGGGTTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025780.3-641s21c1
Sequence:CCGGGCAACTCGAAGGTGGATCAAACTCGAGTTTGATCCACCTTCGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks