EMAIL THIS PAGE TO A FRIEND

THAP3

THAP domain containing, apoptosis associated protein 3

Gene ID:
Mouse(69876) THAP domain containing, apoptosis associated protein 3
Rat(362667) THAP domain containing, apoptosis associated protein 3
cow(508138) THAP domain containing, apoptosis associated protein 3
sheep(101120509) THAP domain containing, apoptosis associated protein 3
naked mole-rat(101698334) THAP domain containing, apoptosis associated protein 3
domestic guinea pig(100732485) THAP domain containing, apoptosis associated protein 3
Zebrafish(541481) THAP domain containing, apoptosis associated protein 3
domestic cat(101095114) THAP domain containing, apoptosis associated protein 3
dog(607727) THAP domain containing, apoptosis associated protein 3
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138350 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138350 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138350 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175152 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175152 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175152 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138350 Rosetta Predictions human pricing
NM_001108695 Rosetta Predictions rat pricing
NM_175152 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138350 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066707 predicted 484
2 SASI_Hs01_00066708 predicted 890
3 SASI_Hs01_00066709 predicted 528
4 SASI_Hs01_00066710 predicted 821
5 SASI_Hs01_00066711 predicted 657
6 SASI_Hs01_00066712 predicted 518
7 SASI_Hs01_00066713 predicted 1035
8 SASI_Hs01_00066714 predicted 870
9 SASI_Hs01_00066715 predicted 702
10 SASI_Hs01_00066716 predicted 259
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108695 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241165 predicted 319
2 SASI_Rn02_00241166 predicted 826
3 SASI_Rn02_00241167 predicted 866
4 SASI_Rn02_00241168 predicted 915
5 SASI_Rn02_00241169 predicted 268
6 SASI_Rn02_00241170 predicted 281
7 SASI_Rn02_00241171 predicted 268
8 SASI_Rn02_00241172 predicted 977
9 SASI_Rn02_00241173 predicted 264
10 SASI_Rn02_00241174 predicted 302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175152 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032913 predicted 860
2 SASI_Mm01_00032914 predicted 232
3 SASI_Mm01_00032915 predicted 266
4 SASI_Mm01_00032916 predicted 858
5 SASI_Mm01_00032917 predicted 203
6 SASI_Mm01_00032918 predicted 213
7 SASI_Mm01_00032919 predicted 221
8 SASI_Mm01_00032920 predicted 754
9 SASI_Mm01_00032921 predicted 805
10 SASI_Mm01_00032922 predicted 249
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138350
VALIDATED
THAP3 MISSION shRNA Bacterial Glycerol Stock
THAP domain containing, apoptosis associated protein 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138350.2-1613s1c1
Sequence:CCGGCGCAATCTGCTCCAGATTCAACTCGAGTTGAATCTGGAGCAGATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152492    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138350.2-1561s1c1
Sequence:CCGGCGACTAATTTCCAAACCCGTTCTCGAGAACGGGTTTGGAAATTAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152636    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138350.2-1621s1c1
Sequence:CCGGGCTCCAGATTCAAGCAGTAATCTCGAGATTACTGCTTGAATCTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153944    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138350.2-596s1c1
Sequence:CCGGCCTGAAGATGAACACACAGTACTCGAGTACTGTGTGTTCATCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138350.2-235s1c1
Sequence:CCGGCGCAAGAACCTAAAGCACAATCTCGAGATTGTGCTTTAGGTTCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138350.2-338s1c1
Sequence:CCGGCCAGCTCTTCTCAGAAAGAAACTCGAGTTTCTTTCTGAGAAGAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_138350.2-234s1c1
Sequence:CCGGCCGCAAGAACCTAAAGCACAACTCGAGTTGTGCTTTAGGTTCTTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138350.2-129s1c1
Sequence:CCGGGAAGGAATGGGTGCTGAACATCTCGAGATGTTCAGCACCCATTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138350.2-240s1c1
Sequence:CCGGGAACCTAAAGCACAATGCCGTCTCGAGACGGCATTGTGCTTTAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138350
VALIDATED
THAP3 MISSION shRNA shRNA Plasmid DNA
THAP domain containing, apoptosis associated protein 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138350.2-1613s1c1
Sequence:CCGGCGCAATCTGCTCCAGATTCAACTCGAGTTGAATCTGGAGCAGATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152492    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138350.2-1561s1c1
Sequence:CCGGCGACTAATTTCCAAACCCGTTCTCGAGAACGGGTTTGGAAATTAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152636    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138350.2-1621s1c1
Sequence:CCGGGCTCCAGATTCAAGCAGTAATCTCGAGATTACTGCTTGAATCTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153944    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138350.2-596s1c1
Sequence:CCGGCCTGAAGATGAACACACAGTACTCGAGTACTGTGTGTTCATCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138350.2-235s1c1
Sequence:CCGGCGCAAGAACCTAAAGCACAATCTCGAGATTGTGCTTTAGGTTCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138350.2-338s1c1
Sequence:CCGGCCAGCTCTTCTCAGAAAGAAACTCGAGTTTCTTTCTGAGAAGAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_138350.2-234s1c1
Sequence:CCGGCCGCAAGAACCTAAAGCACAACTCGAGTTGTGCTTTAGGTTCTTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138350.2-129s1c1
Sequence:CCGGGAAGGAATGGGTGCTGAACATCTCGAGATGTTCAGCACCCATTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138350.2-240s1c1
Sequence:CCGGGAACCTAAAGCACAATGCCGTCTCGAGACGGCATTGTGCTTTAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138350
VALIDATED
THAP3 MISSION shRNA Lentiviral Transduction Particles
THAP domain containing, apoptosis associated protein 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138350.2-1613s1c1
Sequence:CCGGCGCAATCTGCTCCAGATTCAACTCGAGTTGAATCTGGAGCAGATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152492    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138350.2-1561s1c1
Sequence:CCGGCGACTAATTTCCAAACCCGTTCTCGAGAACGGGTTTGGAAATTAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152636    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138350.2-1621s1c1
Sequence:CCGGGCTCCAGATTCAAGCAGTAATCTCGAGATTACTGCTTGAATCTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153944    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138350.2-596s1c1
Sequence:CCGGCCTGAAGATGAACACACAGTACTCGAGTACTGTGTGTTCATCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138350.2-235s1c1
Sequence:CCGGCGCAAGAACCTAAAGCACAATCTCGAGATTGTGCTTTAGGTTCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138350.2-338s1c1
Sequence:CCGGCCAGCTCTTCTCAGAAAGAAACTCGAGTTTCTTTCTGAGAAGAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_138350.2-234s1c1
Sequence:CCGGCCGCAAGAACCTAAAGCACAACTCGAGTTGTGCTTTAGGTTCTTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138350.2-129s1c1
Sequence:CCGGGAAGGAATGGGTGCTGAACATCTCGAGATGTTCAGCACCCATTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138350.2-240s1c1
Sequence:CCGGGAACCTAAAGCACAATGCCGTCTCGAGACGGCATTGTGCTTTAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175152
THAP3 MISSION shRNA Bacterial Glycerol Stock
THAP domain containing, apoptosis associated protein 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175152.2-360s1c1
Sequence:CCGGGACACCACACTGGAAGAACTTCTCGAGAAGTTCTTCCAGTGTGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175152.2-252s1c1
Sequence:CCGGCGCAAGAACCTGAAACACAATCTCGAGATTGTGTTTCAGGTTCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175152.2-411s1c1
Sequence:CCGGCAGGTCTTACCAGATCGAGAACTCGAGTTCTCGATCTGGTAAGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175152.2-251s1c1
Sequence:CCGGCCGCAAGAACCTGAAACACAACTCGAGTTGTGTTTCAGGTTCTTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175152.2-416s1c1
Sequence:CCGGCTTACCAGATCGAGAAGCAATCTCGAGATTGCTTCTCGATCTGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175152
THAP3 MISSION shRNA shRNA Plasmid DNA
THAP domain containing, apoptosis associated protein 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175152.2-360s1c1
Sequence:CCGGGACACCACACTGGAAGAACTTCTCGAGAAGTTCTTCCAGTGTGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175152.2-252s1c1
Sequence:CCGGCGCAAGAACCTGAAACACAATCTCGAGATTGTGTTTCAGGTTCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175152.2-411s1c1
Sequence:CCGGCAGGTCTTACCAGATCGAGAACTCGAGTTCTCGATCTGGTAAGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175152.2-251s1c1
Sequence:CCGGCCGCAAGAACCTGAAACACAACTCGAGTTGTGTTTCAGGTTCTTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175152.2-416s1c1
Sequence:CCGGCTTACCAGATCGAGAAGCAATCTCGAGATTGCTTCTCGATCTGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175152
THAP3 MISSION shRNA Lentiviral Transduction Particles
THAP domain containing, apoptosis associated protein 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175152.2-360s1c1
Sequence:CCGGGACACCACACTGGAAGAACTTCTCGAGAAGTTCTTCCAGTGTGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175152.2-252s1c1
Sequence:CCGGCGCAAGAACCTGAAACACAATCTCGAGATTGTGTTTCAGGTTCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175152.2-411s1c1
Sequence:CCGGCAGGTCTTACCAGATCGAGAACTCGAGTTCTCGATCTGGTAAGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175152.2-251s1c1
Sequence:CCGGCCGCAAGAACCTGAAACACAACTCGAGTTGTGTTTCAGGTTCTTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175152.2-416s1c1
Sequence:CCGGCTTACCAGATCGAGAAGCAATCTCGAGATTGCTTCTCGATCTGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks