EMAIL THIS PAGE TO A FRIEND

THAP4

THAP domain containing 4

Synonyms: PP238
UniProtKB ID: Q8WY91, Q53NU7, Q6GRN0, Q6IPJ3, Q9NW26, Q9Y325
Gene ID:
Mouse(67026) THAP domain containing 4
Rat(363291) THAP domain containing 4
Zebrafish(567037) THAP domain containing 4
chicken(429271) THAP domain containing 4
Horse(100067775) THAP domain containing 4
dog(486208) THAP domain-containing protein 4-like
domestic guinea pig(100723385) THAP domain containing 4
naked mole-rat(101718899) THAP domain containing 4
Domestic Rabbit(100342510) THAP domain containing 4
cow(507503) THAP domain containing 4
sheep(101122490) THAP domain containing 4
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025920 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025920 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025920 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015963 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015963 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015963 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015963 Rosetta Predictions human pricing
NM_001005564 Rosetta Predictions rat pricing
NM_025920 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015963 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070066 predicted 1043
2 SASI_Hs01_00070068 predicted 383
3 SASI_Hs01_00070070 predicted 631
4 SASI_Hs01_00070071 predicted 1827
5 SASI_Hs01_00070072 predicted 1773
6 SASI_Hs01_00070073 predicted 1016
7 SASI_Hs02_00348627 predicted 1078
8 SASI_Hs02_00348628 predicted 1696
9 SASI_Hs02_00348629 predicted 1250
10 SASI_Hs02_00348630 predicted 1239
11 SASI_Hs01_00070064 predicted 1845
12 SASI_Hs01_00070065 predicted 1618
13 SASI_Hs01_00070067 predicted 1656
14 SASI_Hs01_00070069 predicted 943
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005564 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198429 predicted 391
2 SASI_Rn01_00042739 predicted 1400
3 SASI_Rn01_00042740 predicted 665
4 SASI_Rn01_00042741 predicted 1622
5 SASI_Rn01_00042742 predicted 1630
6 SASI_Rn01_00042743 predicted 409
7 SASI_Rn01_00042744 predicted 713
8 SASI_Rn01_00042745 predicted 718
9 SASI_Rn01_00042746 predicted 1699
10 SASI_Rn01_00042747 predicted 413
11 SASI_Rn01_00042748 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025920 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139817 predicted 1668
2 SASI_Mm01_00139818 predicted 915
3 SASI_Mm01_00139819 predicted 930
4 SASI_Mm01_00139820 predicted 1885
5 SASI_Mm01_00139821 predicted 984
6 SASI_Mm01_00139822 predicted 1894
7 SASI_Mm01_00139823 predicted 926
8 SASI_Mm01_00139824 predicted 657
9 SASI_Mm01_00139825 predicted 399
10 SASI_Mm01_00139826 predicted 991
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025920
THAP4 MISSION shRNA Bacterial Glycerol Stock
THAP domain containing 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025920.2-962s1c1
Sequence:CCGGGCCTATGCTCAACTTCTCGTTCTCGAGAACGAGAAGTTGAGCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025920.2-1050s1c1
Sequence:CCGGGACACCAACAAAGTGGCCTTTCTCGAGAAAGGCCACTTTGTTGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025920.2-1225s1c1
Sequence:CCGGGCAAACTTGAACAGACGGTCTCTCGAGAGACCGTCTGTTCAAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025920.2-671s1c1
Sequence:CCGGGAAGAAGAATGGAGAGCTAAACTCGAGTTTAGCTCTCCATTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025920.3-1752s21c1
Sequence:CCGGGACACCAACAAAGTGGCCTTTCTCGAGAAAGGCCACTTTGTTGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025920.3-1373s21c1
Sequence:CCGGGAAGAAGAATGGAGAGCTAAACTCGAGTTTAGCTCTCCATTCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025920.3-1664s21c1
Sequence:CCGGGCCTATGCTCAACTTCTCGTTCTCGAGAACGAGAAGTTGAGCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025920.3-1927s21c1
Sequence:CCGGGCAAACTTGAACAGACGGTCTCTCGAGAGACCGTCTGTTCAAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025920
THAP4 MISSION shRNA shRNA Plasmid DNA
THAP domain containing 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025920.2-962s1c1
Sequence:CCGGGCCTATGCTCAACTTCTCGTTCTCGAGAACGAGAAGTTGAGCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025920.2-1050s1c1
Sequence:CCGGGACACCAACAAAGTGGCCTTTCTCGAGAAAGGCCACTTTGTTGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025920.2-1225s1c1
Sequence:CCGGGCAAACTTGAACAGACGGTCTCTCGAGAGACCGTCTGTTCAAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025920.2-671s1c1
Sequence:CCGGGAAGAAGAATGGAGAGCTAAACTCGAGTTTAGCTCTCCATTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025920.3-1752s21c1
Sequence:CCGGGACACCAACAAAGTGGCCTTTCTCGAGAAAGGCCACTTTGTTGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025920.3-1373s21c1
Sequence:CCGGGAAGAAGAATGGAGAGCTAAACTCGAGTTTAGCTCTCCATTCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025920.3-1664s21c1
Sequence:CCGGGCCTATGCTCAACTTCTCGTTCTCGAGAACGAGAAGTTGAGCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025920.3-1927s21c1
Sequence:CCGGGCAAACTTGAACAGACGGTCTCTCGAGAGACCGTCTGTTCAAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025920
THAP4 MISSION shRNA Lentiviral Transduction Particles
THAP domain containing 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025920.2-962s1c1
Sequence:CCGGGCCTATGCTCAACTTCTCGTTCTCGAGAACGAGAAGTTGAGCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025920.2-1050s1c1
Sequence:CCGGGACACCAACAAAGTGGCCTTTCTCGAGAAAGGCCACTTTGTTGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025920.2-1225s1c1
Sequence:CCGGGCAAACTTGAACAGACGGTCTCTCGAGAGACCGTCTGTTCAAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025920.2-671s1c1
Sequence:CCGGGAAGAAGAATGGAGAGCTAAACTCGAGTTTAGCTCTCCATTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025920.3-1752s21c1
Sequence:CCGGGACACCAACAAAGTGGCCTTTCTCGAGAAAGGCCACTTTGTTGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025920.3-1373s21c1
Sequence:CCGGGAAGAAGAATGGAGAGCTAAACTCGAGTTTAGCTCTCCATTCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025920.3-1664s21c1
Sequence:CCGGGCCTATGCTCAACTTCTCGTTCTCGAGAACGAGAAGTTGAGCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025920.3-1927s21c1
Sequence:CCGGGCAAACTTGAACAGACGGTCTCTCGAGAGACCGTCTGTTCAAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015963
VALIDATED
THAP4 MISSION shRNA Bacterial Glycerol Stock
THAP domain containing 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015963.4-905s1c1
Sequence:CCGGGCGTGCAAATTTATCGGCTCACTCGAGTGAGCCGATAAATTTGCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015963.4-934s1c1
Sequence:CCGGGTACAGTTTCTCCTCTAAGCACTCGAGTGCTTAGAGGAGAAACTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015963.4-855s1c1
Sequence:CCGGCAGATAAGAGTGGCATTTCTACTCGAGTAGAAATGCCACTCTTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015963.4-381s1c1
Sequence:CCGGCATTTCTCTGTAGTGAGCATTCTCGAGAATGCTCACTACAGAGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015963.4-364s1c1
Sequence:CCGGGACTCCCACTAAGTATTCATTCTCGAGAATGAATACTTAGTGGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015963.4-397s1c1
Sequence:CCGGGCATTTCACCAAAGACAGCTTCTCGAGAAGCTGTCTTTGGTGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015963.4-1661s1c1
Sequence:CCGGCACAGAGAGTGTGGCTTCATTCTCGAGAATGAAGCCACACTCTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015963.5-542s21c1
Sequence:CCGGCATCTTCCACCTGACCGAGAACTCGAGTTCTCGGTCAGGTGGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015963.5-392s21c1
Sequence:CCGGACGTCTAATCCAATGGTTAAACTCGAGTTTAACCATTGGATTAGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015963.5-1739s21c1
Sequence:CCGGGTGTGGCTTCATTCGCCTCAACTCGAGTTGAGGCGAATGAAGCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015963
VALIDATED
THAP4 MISSION shRNA shRNA Plasmid DNA
THAP domain containing 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015963.4-905s1c1
Sequence:CCGGGCGTGCAAATTTATCGGCTCACTCGAGTGAGCCGATAAATTTGCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015963.4-934s1c1
Sequence:CCGGGTACAGTTTCTCCTCTAAGCACTCGAGTGCTTAGAGGAGAAACTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015963.4-855s1c1
Sequence:CCGGCAGATAAGAGTGGCATTTCTACTCGAGTAGAAATGCCACTCTTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015963.4-381s1c1
Sequence:CCGGCATTTCTCTGTAGTGAGCATTCTCGAGAATGCTCACTACAGAGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015963.4-364s1c1
Sequence:CCGGGACTCCCACTAAGTATTCATTCTCGAGAATGAATACTTAGTGGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015963.4-397s1c1
Sequence:CCGGGCATTTCACCAAAGACAGCTTCTCGAGAAGCTGTCTTTGGTGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015963.4-1661s1c1
Sequence:CCGGCACAGAGAGTGTGGCTTCATTCTCGAGAATGAAGCCACACTCTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015963.5-542s21c1
Sequence:CCGGCATCTTCCACCTGACCGAGAACTCGAGTTCTCGGTCAGGTGGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015963.5-392s21c1
Sequence:CCGGACGTCTAATCCAATGGTTAAACTCGAGTTTAACCATTGGATTAGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015963.5-1739s21c1
Sequence:CCGGGTGTGGCTTCATTCGCCTCAACTCGAGTTGAGGCGAATGAAGCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015963
VALIDATED
THAP4 MISSION shRNA Lentiviral Transduction Particles
THAP domain containing 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015963.4-905s1c1
Sequence:CCGGGCGTGCAAATTTATCGGCTCACTCGAGTGAGCCGATAAATTTGCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015963.4-934s1c1
Sequence:CCGGGTACAGTTTCTCCTCTAAGCACTCGAGTGCTTAGAGGAGAAACTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015963.4-855s1c1
Sequence:CCGGCAGATAAGAGTGGCATTTCTACTCGAGTAGAAATGCCACTCTTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015963.4-381s1c1
Sequence:CCGGCATTTCTCTGTAGTGAGCATTCTCGAGAATGCTCACTACAGAGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015963.4-364s1c1
Sequence:CCGGGACTCCCACTAAGTATTCATTCTCGAGAATGAATACTTAGTGGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015963.4-397s1c1
Sequence:CCGGGCATTTCACCAAAGACAGCTTCTCGAGAAGCTGTCTTTGGTGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015963.4-1661s1c1
Sequence:CCGGCACAGAGAGTGTGGCTTCATTCTCGAGAATGAAGCCACACTCTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015963.5-542s21c1
Sequence:CCGGCATCTTCCACCTGACCGAGAACTCGAGTTCTCGGTCAGGTGGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015963.5-392s21c1
Sequence:CCGGACGTCTAATCCAATGGTTAAACTCGAGTTTAACCATTGGATTAGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015963.5-1739s21c1
Sequence:CCGGGTGTGGCTTCATTCGCCTCAACTCGAGTTGAGGCGAATGAAGCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks