EMAIL THIS PAGE TO A FRIEND

THAP5

THAP domain containing 5

UniProtKB ID: Q7Z6K1
Gene ID:
cow(614615) THAP domain containing 5
sheep(101114099) THAP domain containing 5
naked mole-rat(101725098) THAP domain containing 5
domestic guinea pig(100730549) THAP domain containing 5
chicken(417784) THAP domain containing 5
dog(482404) THAP domain containing 5
domestic cat(101081619) THAP domain containing 5
Horse(100070659) THAP domain containing 5
26 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182529 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182529 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182529 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU115311 MISSION® esiRNA esiRNA human THAP5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182529 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182529 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223035 predicted 934
2 SASI_Hs01_00223036 predicted 795
3 SASI_Hs01_00223037 predicted 864
4 SASI_Hs01_00223039 predicted 1158
5 SASI_Hs02_00370620 predicted 1018
6 SASI_Hs02_00370621 predicted 1327
7 SASI_Hs02_00370622 predicted 1067
8 SASI_Hs02_00370623 predicted 1182
9 SASI_Hs02_00370624 predicted 1203
10 SASI_Hs02_00370625 predicted 1036
11 SASI_Hs01_00223038 predicted 959
12 SASI_Hs01_00223040 predicted 870
13 SASI_Hs01_00223041 predicted 979
14 SASI_Hs01_00223042 predicted 818
15 SASI_Hs01_00223043 predicted 1309
16 SASI_Hs01_00223044 predicted 1333
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182529
THAP5 MISSION shRNA Bacterial Glycerol Stock
THAP domain containing 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136475    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182529.1-1281s1c1
Sequence:CCGGCAGAAAGTCTCTAAGCTACATCTCGAGATGTAGCTTAGAGACTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182529.1-1509s1c1
Sequence:CCGGGCCAAACCAAACTACATGTAACTCGAGTTACATGTAGTTTGGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182529.1-1188s1c1
Sequence:CCGGGACTCCTTGTATAAGGATGTACTCGAGTACATCCTTATACAAGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182529.1-948s1c1
Sequence:CCGGCTTGAAGTAACTACCAGTCATCTCGAGATGACTGGTAGTTACTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182529.1-1352s1c1
Sequence:CCGGGAAGTCTTTGGAAGCTCTTATCTCGAGATAAGAGCTTCCAAAGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182529.1-951s1c1
Sequence:CCGGGAAGTAACTACCAGTCATCTTCTCGAGAAGATGACTGGTAGTTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182529.1-1179s1c1
Sequence:CCGGGACATTGAAGACTCCTTGTATCTCGAGATACAAGGAGTCTTCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182529.1-1164s1c1
Sequence:CCGGGAAATGGAAGACACAGACATTCTCGAGAATGTCTGTGTCTTCCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182529.1-1002s1c1
Sequence:CCGGGAAATAAAGTCAGCACAGGAACTCGAGTTCCTGTGCTGACTTTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182529
THAP5 MISSION shRNA shRNA Plasmid DNA
THAP domain containing 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136475    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182529.1-1281s1c1
Sequence:CCGGCAGAAAGTCTCTAAGCTACATCTCGAGATGTAGCTTAGAGACTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182529.1-1509s1c1
Sequence:CCGGGCCAAACCAAACTACATGTAACTCGAGTTACATGTAGTTTGGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182529.1-1188s1c1
Sequence:CCGGGACTCCTTGTATAAGGATGTACTCGAGTACATCCTTATACAAGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182529.1-948s1c1
Sequence:CCGGCTTGAAGTAACTACCAGTCATCTCGAGATGACTGGTAGTTACTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182529.1-1352s1c1
Sequence:CCGGGAAGTCTTTGGAAGCTCTTATCTCGAGATAAGAGCTTCCAAAGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182529.1-951s1c1
Sequence:CCGGGAAGTAACTACCAGTCATCTTCTCGAGAAGATGACTGGTAGTTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182529.1-1179s1c1
Sequence:CCGGGACATTGAAGACTCCTTGTATCTCGAGATACAAGGAGTCTTCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182529.1-1164s1c1
Sequence:CCGGGAAATGGAAGACACAGACATTCTCGAGAATGTCTGTGTCTTCCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182529.1-1002s1c1
Sequence:CCGGGAAATAAAGTCAGCACAGGAACTCGAGTTCCTGTGCTGACTTTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182529
THAP5 MISSION shRNA Lentiviral Transduction Particles
THAP domain containing 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136475    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182529.1-1281s1c1
Sequence:CCGGCAGAAAGTCTCTAAGCTACATCTCGAGATGTAGCTTAGAGACTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182529.1-1509s1c1
Sequence:CCGGGCCAAACCAAACTACATGTAACTCGAGTTACATGTAGTTTGGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182529.1-1188s1c1
Sequence:CCGGGACTCCTTGTATAAGGATGTACTCGAGTACATCCTTATACAAGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182529.1-948s1c1
Sequence:CCGGCTTGAAGTAACTACCAGTCATCTCGAGATGACTGGTAGTTACTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182529.1-1352s1c1
Sequence:CCGGGAAGTCTTTGGAAGCTCTTATCTCGAGATAAGAGCTTCCAAAGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182529.1-951s1c1
Sequence:CCGGGAAGTAACTACCAGTCATCTTCTCGAGAAGATGACTGGTAGTTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182529.1-1179s1c1
Sequence:CCGGGACATTGAAGACTCCTTGTATCTCGAGATACAAGGAGTCTTCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182529.1-1164s1c1
Sequence:CCGGGAAATGGAAGACACAGACATTCTCGAGAATGTCTGTGTCTTCCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182529.1-1002s1c1
Sequence:CCGGGAAATAAAGTCAGCACAGGAACTCGAGTTCCTGTGCTGACTTTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks