EMAIL THIS PAGE TO A FRIEND

THAP6

THAP domain containing 6

UniProtKB ID: Q8TBB0, Q5HYJ7, Q5JPC6
Gene ID:
Mouse(381650) THAP domain containing 6
Rat(305244) THAP domain containing 6
domestic cat(101080378) THAP domain containing 6
dog(487811) THAP domain containing 6
domestic guinea pig(100733569) THAP domain containing 6
naked mole-rat(101701028) THAP domain containing 6
cow(539787) THAP domain containing 6
sheep(101106329) THAP domain containing 6
173 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144721 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144721 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144721 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_975229 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_975229 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_975229 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU009001 MISSION® esiRNA esiRNA targeting human THAP6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144721 Rosetta Predictions human pricing
NM_001107209 Rosetta Predictions rat pricing
XM_975229 Rosetta Predictions mouse pricing
XM_980102 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144721 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149869 predicted 482
2 SASI_Hs01_00149870 predicted 708
3 SASI_Hs01_00149871 predicted 313
4 SASI_Hs01_00149872 predicted 266
5 SASI_Hs01_00149873 predicted 582
6 SASI_Hs01_00149875 predicted 534
7 SASI_Hs01_00149876 predicted 520
8 SASI_Hs02_00364667 predicted 735
9 SASI_Hs02_00364668 predicted 739
10 SASI_Hs02_00364669 predicted 634
11 SASI_Hs01_00149868 predicted 791
12 SASI_Hs01_00149874 predicted 286
13 SASI_Hs01_00149877 predicted 514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107209 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226585 predicted 1309
2 SASI_Rn02_00226586 predicted 1068
3 SASI_Rn02_00226587 predicted 1567
4 SASI_Rn02_00226588 predicted 1436
5 SASI_Rn02_00226589 predicted 626
6 SASI_Rn02_00226590 predicted 1531
7 SASI_Rn02_00226591 predicted 1557
8 SASI_Rn02_00226592 predicted 1402
9 SASI_Rn02_00226593 predicted 832
10 SASI_Rn02_00226594 predicted 1077
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_975229 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00445590 predicted 1100
2 SASI_Mm02_00445591 predicted 1088
3 SASI_Mm02_00445592 predicted 665
4 SASI_Mm02_00445593 predicted 1283
5 SASI_Mm02_00445594 predicted 1154
6 SASI_Mm02_00445595 predicted 1317
7 SASI_Mm02_00445596 predicted 1255
8 SASI_Mm02_00445597 predicted 1359
9 SASI_Mm02_00445598 predicted 695
10 SASI_Mm02_00445599 predicted 765
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_980102 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00250653 predicted 1096
2 SASI_Mm01_00250654 predicted 1088
3 SASI_Mm01_00250655 predicted 659
4 SASI_Mm01_00250656 predicted 1287
5 SASI_Mm01_00250657 predicted 1155
6 SASI_Mm01_00250659 predicted 1317
7 SASI_Mm01_00250660 predicted 1258
8 SASI_Mm01_00250661 predicted 1354
9 SASI_Mm01_00250662 predicted 696
10 SASI_Mm02_00447150 predicted 768
11 SASI_Mm01_00250658 predicted 818
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144721
VALIDATED
THAP6 MISSION shRNA Bacterial Glycerol Stock
THAP domain containing 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_144721.3-696s1c1
Sequence:CCGGGACTGTTGTCAGGAGAGCATACTCGAGTATGCTCTCCTGACAACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144721.3-324s1c1
Sequence:CCGGCCTTCTATCTTTGATTCTCCACTCGAGTGGAGAATCAAAGATAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144721.3-2650s1c1
Sequence:CCGGCCTAATGGAAAGTTTGGGTATCTCGAGATACCCAAACTTTCCATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144721.3-441s1c1
Sequence:CCGGGCTTCCTCATGTATTGAAGAACTCGAGTTCTTCAATACATGAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144721.3-555s1c1
Sequence:CCGGGAGGATACAAAGGAAAGTCTACTCGAGTAGACTTTCCTTTGTATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144721.4-470s21c1
Sequence:CCGGGCTTCCTCATGTATTGAAGAACTCGAGTTCTTCAATACATGAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144721.4-584s21c1
Sequence:CCGGGAGGATACAAAGGAAAGTCTACTCGAGTAGACTTTCCTTTGTATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322674    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144721.4-1225s21c1
Sequence:CCGGGATTCAATCCAAGGTGCTTTACTCGAGTAAAGCACCTTGGATTGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144721.4-353s21c1
Sequence:CCGGCCTTCTATCTTTGATTCTCCACTCGAGTGGAGAATCAAAGATAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144721
VALIDATED
THAP6 MISSION shRNA shRNA Plasmid DNA
THAP domain containing 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_144721.3-696s1c1
Sequence:CCGGGACTGTTGTCAGGAGAGCATACTCGAGTATGCTCTCCTGACAACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144721.3-324s1c1
Sequence:CCGGCCTTCTATCTTTGATTCTCCACTCGAGTGGAGAATCAAAGATAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144721.3-2650s1c1
Sequence:CCGGCCTAATGGAAAGTTTGGGTATCTCGAGATACCCAAACTTTCCATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144721.3-441s1c1
Sequence:CCGGGCTTCCTCATGTATTGAAGAACTCGAGTTCTTCAATACATGAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144721.3-555s1c1
Sequence:CCGGGAGGATACAAAGGAAAGTCTACTCGAGTAGACTTTCCTTTGTATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144721.4-470s21c1
Sequence:CCGGGCTTCCTCATGTATTGAAGAACTCGAGTTCTTCAATACATGAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144721.4-584s21c1
Sequence:CCGGGAGGATACAAAGGAAAGTCTACTCGAGTAGACTTTCCTTTGTATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322674    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144721.4-1225s21c1
Sequence:CCGGGATTCAATCCAAGGTGCTTTACTCGAGTAAAGCACCTTGGATTGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144721.4-353s21c1
Sequence:CCGGCCTTCTATCTTTGATTCTCCACTCGAGTGGAGAATCAAAGATAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144721
VALIDATED
THAP6 MISSION shRNA Lentiviral Transduction Particles
THAP domain containing 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_144721.3-696s1c1
Sequence:CCGGGACTGTTGTCAGGAGAGCATACTCGAGTATGCTCTCCTGACAACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144721.3-324s1c1
Sequence:CCGGCCTTCTATCTTTGATTCTCCACTCGAGTGGAGAATCAAAGATAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144721.3-2650s1c1
Sequence:CCGGCCTAATGGAAAGTTTGGGTATCTCGAGATACCCAAACTTTCCATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144721.3-441s1c1
Sequence:CCGGGCTTCCTCATGTATTGAAGAACTCGAGTTCTTCAATACATGAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144721.3-555s1c1
Sequence:CCGGGAGGATACAAAGGAAAGTCTACTCGAGTAGACTTTCCTTTGTATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144721.4-470s21c1
Sequence:CCGGGCTTCCTCATGTATTGAAGAACTCGAGTTCTTCAATACATGAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144721.4-584s21c1
Sequence:CCGGGAGGATACAAAGGAAAGTCTACTCGAGTAGACTTTCCTTTGTATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322674    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144721.4-1225s21c1
Sequence:CCGGGATTCAATCCAAGGTGCTTTACTCGAGTAAAGCACCTTGGATTGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144721.4-353s21c1
Sequence:CCGGCCTTCTATCTTTGATTCTCCACTCGAGTGGAGAATCAAAGATAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_975229
THAP6 MISSION shRNA Bacterial Glycerol Stock
THAP domain containing 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_975229.1-875s21c1
Sequence:CCGGCTTTGACAGAAGCACTCTAAACTCGAGTTTAGAGTGCTTCTGTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_975229.1-1319s21c1
Sequence:CCGGCTGTAGTTTGTGAAGTCATTTCTCGAGAAATGACTTCACAAACTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235334    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_975229.1-1533s21c1
Sequence:CCGGCACTACTCCAAGGGAGTTAAACTCGAGTTTAACTCCCTTGGAGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_975229.1-931s21c1
Sequence:CCGGTTGAATGTCCATATCACTTACCTCGAGGTAAGTGATATGGACATTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_975229.1-696s21c1
Sequence:CCGGCCTCTCGCTGTTTACCAAATTCTCGAGAATTTGGTAAACAGCGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_975229
THAP6 MISSION shRNA shRNA Plasmid DNA
THAP domain containing 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_975229.1-875s21c1
Sequence:CCGGCTTTGACAGAAGCACTCTAAACTCGAGTTTAGAGTGCTTCTGTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_975229.1-1319s21c1
Sequence:CCGGCTGTAGTTTGTGAAGTCATTTCTCGAGAAATGACTTCACAAACTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235334    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_975229.1-1533s21c1
Sequence:CCGGCACTACTCCAAGGGAGTTAAACTCGAGTTTAACTCCCTTGGAGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_975229.1-931s21c1
Sequence:CCGGTTGAATGTCCATATCACTTACCTCGAGGTAAGTGATATGGACATTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_975229.1-696s21c1
Sequence:CCGGCCTCTCGCTGTTTACCAAATTCTCGAGAATTTGGTAAACAGCGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_975229
THAP6 MISSION shRNA Lentiviral Transduction Particles
THAP domain containing 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_975229.1-875s21c1
Sequence:CCGGCTTTGACAGAAGCACTCTAAACTCGAGTTTAGAGTGCTTCTGTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_975229.1-1319s21c1
Sequence:CCGGCTGTAGTTTGTGAAGTCATTTCTCGAGAAATGACTTCACAAACTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235334    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_975229.1-1533s21c1
Sequence:CCGGCACTACTCCAAGGGAGTTAAACTCGAGTTTAACTCCCTTGGAGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_975229.1-931s21c1
Sequence:CCGGTTGAATGTCCATATCACTTACCTCGAGGTAAGTGATATGGACATTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_975229.1-696s21c1
Sequence:CCGGCCTCTCGCTGTTTACCAAATTCTCGAGAATTTGGTAAACAGCGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks