EMAIL THIS PAGE TO A FRIEND

THAP7

THAP domain containing 7

UniProtKB ID: Q9BT49, B2RD97, D3DX40
Gene ID:
Mouse(69009) THAP domain containing 7
Rat(287944) THAP domain containing 7
cow(789768) THAP domain containing 7
naked mole-rat(101703170) THAP domain containing 7
domestic guinea pig(100725160) THAP domain containing 7
Zebrafish(100006965) THAP domain containing 7
chicken(776094) THAP domain containing 7
domestic cat(101083977) THAP domain containing 7
dog(486438) THAP domain containing 7
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA003083 Anti-THAP7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030573 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030573 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030573 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026909 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026909 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026909 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008695 Rosetta Predictions human pricing
NM_001008696 Rosetta Predictions human pricing
NM_030573 Rosetta Predictions human pricing
NM_001105863 Rosetta Predictions rat pricing
NM_026909 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008695 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084619 predicted 697
2 SASI_Hs02_00305527 predicted 251
3 SASI_Hs02_00305528 predicted 240
4 SASI_Hs02_00305529 predicted 257
5 SASI_Hs01_00084620 predicted 764
6 SASI_Hs02_00305530 predicted 263
7 SASI_Hs01_00084621 predicted 326
8 SASI_Hs02_00305531 predicted 294
9 SASI_Hs01_00084622 predicted 659
10 SASI_Hs01_00084623 predicted 458
11 SASI_Hs01_00084624 predicted 343
12 SASI_Hs01_00084625 predicted 774
13 SASI_Hs01_00084626 predicted 841
14 SASI_Hs01_00084627 predicted 466
15 SASI_Hs01_00084628 predicted 460
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008696 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091931 predicted 817
2 SASI_Hs01_00091932 predicted 811
3 SASI_Hs01_00091933 predicted 813
4 SASI_Hs01_00091934 predicted 891
5 SASI_Hs01_00091935 predicted 807
6 SASI_Hs01_00091936 predicted 889
7 SASI_Hs01_00091937 predicted 942
8 SASI_Hs01_00091938 predicted 955
9 SASI_Hs01_00091939 predicted 887
10 SASI_Hs01_00091940 predicted 806
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030573 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031728 predicted 868
2 SASI_Hs02_00358141 predicted 431
3 SASI_Hs02_00358142 predicted 417
4 SASI_Hs02_00358143 predicted 426
5 SASI_Hs01_00031729 predicted 939
6 SASI_Hs02_00358144 predicted 436
7 SASI_Hs01_00031730 predicted 507
8 SASI_Hs02_00358145 predicted 470
9 SASI_Hs01_00031731 predicted 834
10 SASI_Hs01_00031732 predicted 633
11 SASI_Hs01_00031733 predicted 521
12 SASI_Hs01_00031734 predicted 942
13 SASI_Hs01_00031735 predicted 1005
14 SASI_Hs01_00031736 predicted 637
15 SASI_Hs01_00031737 predicted 626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105863 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213272 predicted 689
2 SASI_Rn02_00213273 predicted 899
3 SASI_Rn02_00213274 predicted 833
4 SASI_Rn02_00213275 predicted 694
5 SASI_Rn02_00213276 predicted 713
6 SASI_Rn02_00213277 predicted 766
7 SASI_Rn02_00213278 predicted 769
8 SASI_Rn02_00213279 predicted 816
9 SASI_Rn02_00213280 predicted 765
10 SASI_Rn02_00213281 predicted 898
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026909 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140778 predicted 879
2 SASI_Mm01_00140779 predicted 902
3 SASI_Mm01_00140780 predicted 252
4 SASI_Mm01_00140781 predicted 213
5 SASI_Mm01_00140782 predicted 901
6 SASI_Mm01_00140783 predicted 321
7 SASI_Mm01_00140784 predicted 926
8 SASI_Mm01_00140785 predicted 254
9 SASI_Mm01_00140786 predicted 206
10 SASI_Mm01_00140787 predicted 706
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030573
VALIDATED
THAP7 MISSION shRNA Bacterial Glycerol Stock
THAP domain containing 7
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030573.2-373s21c1
Sequence:CCGGGCATCCGAGTACATCTACTTCCTCGAGGAAGTAGATGTACTCGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030573.2-282s21c1
Sequence:CCGGCAGACTTCCCAAGAAGGACAACTCGAGTTGTCCTTCTTGGGAAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030573.2-885s21c1
Sequence:CCGGGAATGAACACAGCTACCAGGTCTCGAGACCTGGTAGCTGTGTTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030573.2-477s21c1
Sequence:CCGGCATATTTGAGTCTTTCTCCAACTCGAGTTGGAGAAAGACTCAAATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030573.2-381s21c1
Sequence:CCGGGTACATCTACTTCTGCTCCAACTCGAGTTGGAGCAGAAGTAGATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_030573.1-253s1c1
Sequence:CCGGCAGACTTCCCAAGAAGGACAACTCGAGTTGTCCTTCTTGGGAAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_030573.1-344s1c1
Sequence:CCGGGCATCCGAGTACATCTACTTCCTCGAGGAAGTAGATGTACTCGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_030573.1-856s1c1
Sequence:CCGGGAATGAACACAGCTACCAGGTCTCGAGACCTGGTAGCTGTGTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_030573.1-448s1c1
Sequence:CCGGCATATTTGAGTCTTTCTCCAACTCGAGTTGGAGAAAGACTCAAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_030573.1-352s1c1
Sequence:CCGGGTACATCTACTTCTGCTCCAACTCGAGTTGGAGCAGAAGTAGATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030573.1-478s1c1
Sequence:CCGGGACAACCAAGACCAAAGGACACTCGAGTGTCCTTTGGTCTTGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030573
VALIDATED
THAP7 MISSION shRNA shRNA Plasmid DNA
THAP domain containing 7
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030573.2-373s21c1
Sequence:CCGGGCATCCGAGTACATCTACTTCCTCGAGGAAGTAGATGTACTCGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030573.2-282s21c1
Sequence:CCGGCAGACTTCCCAAGAAGGACAACTCGAGTTGTCCTTCTTGGGAAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030573.2-885s21c1
Sequence:CCGGGAATGAACACAGCTACCAGGTCTCGAGACCTGGTAGCTGTGTTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030573.2-477s21c1
Sequence:CCGGCATATTTGAGTCTTTCTCCAACTCGAGTTGGAGAAAGACTCAAATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030573.2-381s21c1
Sequence:CCGGGTACATCTACTTCTGCTCCAACTCGAGTTGGAGCAGAAGTAGATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_030573.1-253s1c1
Sequence:CCGGCAGACTTCCCAAGAAGGACAACTCGAGTTGTCCTTCTTGGGAAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_030573.1-344s1c1
Sequence:CCGGGCATCCGAGTACATCTACTTCCTCGAGGAAGTAGATGTACTCGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_030573.1-856s1c1
Sequence:CCGGGAATGAACACAGCTACCAGGTCTCGAGACCTGGTAGCTGTGTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_030573.1-448s1c1
Sequence:CCGGCATATTTGAGTCTTTCTCCAACTCGAGTTGGAGAAAGACTCAAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_030573.1-352s1c1
Sequence:CCGGGTACATCTACTTCTGCTCCAACTCGAGTTGGAGCAGAAGTAGATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030573.1-478s1c1
Sequence:CCGGGACAACCAAGACCAAAGGACACTCGAGTGTCCTTTGGTCTTGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030573
VALIDATED
THAP7 MISSION shRNA Lentiviral Transduction Particles
THAP domain containing 7
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030573.2-373s21c1
Sequence:CCGGGCATCCGAGTACATCTACTTCCTCGAGGAAGTAGATGTACTCGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030573.2-282s21c1
Sequence:CCGGCAGACTTCCCAAGAAGGACAACTCGAGTTGTCCTTCTTGGGAAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030573.2-885s21c1
Sequence:CCGGGAATGAACACAGCTACCAGGTCTCGAGACCTGGTAGCTGTGTTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030573.2-477s21c1
Sequence:CCGGCATATTTGAGTCTTTCTCCAACTCGAGTTGGAGAAAGACTCAAATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030573.2-381s21c1
Sequence:CCGGGTACATCTACTTCTGCTCCAACTCGAGTTGGAGCAGAAGTAGATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_030573.1-253s1c1
Sequence:CCGGCAGACTTCCCAAGAAGGACAACTCGAGTTGTCCTTCTTGGGAAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_030573.1-344s1c1
Sequence:CCGGGCATCCGAGTACATCTACTTCCTCGAGGAAGTAGATGTACTCGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_030573.1-856s1c1
Sequence:CCGGGAATGAACACAGCTACCAGGTCTCGAGACCTGGTAGCTGTGTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_030573.1-448s1c1
Sequence:CCGGCATATTTGAGTCTTTCTCCAACTCGAGTTGGAGAAAGACTCAAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_030573.1-352s1c1
Sequence:CCGGGTACATCTACTTCTGCTCCAACTCGAGTTGGAGCAGAAGTAGATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030573.1-478s1c1
Sequence:CCGGGACAACCAAGACCAAAGGACACTCGAGTGTCCTTTGGTCTTGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026909
VALIDATED
THAP7 MISSION shRNA Bacterial Glycerol Stock
THAP domain containing 7
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026909.2-296s21c1
Sequence:CCGGCCCACCATATTTGAGTCTTTCCTCGAGGAAAGACTCAAATATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026909.2-191s21c1
Sequence:CCGGGATCCGACCTCTGAGTACATCCTCGAGGATGTACTCAGAGGTCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026909.2-907s21c1
Sequence:CCGGGAAGGACCATGTACAGGACTTCTCGAGAAGTCCTGTACATGGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026909.2-932s21c1
Sequence:CCGGATGCAGTTGAGCAGCAGTATGCTCGAGCATACTGCTGCTCAACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026909.2-103s21c1
Sequence:CCGGCCACAGACTTCCCAAGAAAGACTCGAGTCTTTCTTGGGAAGTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026909.1-219s1c1
Sequence:CCGGGCTCCAAACACTTCGAGGAAACTCGAGTTTCCTCGAAGTGTTTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026909.1-907s1c1
Sequence:CCGGGAAGGACCATGTACAGGACTTCTCGAGAAGTCCTGTACATGGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026909.1-103s1c1
Sequence:CCGGCCACAGACTTCCCAAGAAAGACTCGAGTCTTTCTTGGGAAGTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193015    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026909.1-1029s1c1
Sequence:CCGGGCTGGCCAAATGTTACAATAACTCGAGTTATTGTAACATTTGGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026909
VALIDATED
THAP7 MISSION shRNA shRNA Plasmid DNA
THAP domain containing 7
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026909.2-296s21c1
Sequence:CCGGCCCACCATATTTGAGTCTTTCCTCGAGGAAAGACTCAAATATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026909.2-191s21c1
Sequence:CCGGGATCCGACCTCTGAGTACATCCTCGAGGATGTACTCAGAGGTCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026909.2-907s21c1
Sequence:CCGGGAAGGACCATGTACAGGACTTCTCGAGAAGTCCTGTACATGGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026909.2-932s21c1
Sequence:CCGGATGCAGTTGAGCAGCAGTATGCTCGAGCATACTGCTGCTCAACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026909.2-103s21c1
Sequence:CCGGCCACAGACTTCCCAAGAAAGACTCGAGTCTTTCTTGGGAAGTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026909.1-219s1c1
Sequence:CCGGGCTCCAAACACTTCGAGGAAACTCGAGTTTCCTCGAAGTGTTTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026909.1-907s1c1
Sequence:CCGGGAAGGACCATGTACAGGACTTCTCGAGAAGTCCTGTACATGGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026909.1-103s1c1
Sequence:CCGGCCACAGACTTCCCAAGAAAGACTCGAGTCTTTCTTGGGAAGTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193015    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026909.1-1029s1c1
Sequence:CCGGGCTGGCCAAATGTTACAATAACTCGAGTTATTGTAACATTTGGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026909
VALIDATED
THAP7 MISSION shRNA Lentiviral Transduction Particles
THAP domain containing 7
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026909.2-296s21c1
Sequence:CCGGCCCACCATATTTGAGTCTTTCCTCGAGGAAAGACTCAAATATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026909.2-191s21c1
Sequence:CCGGGATCCGACCTCTGAGTACATCCTCGAGGATGTACTCAGAGGTCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026909.2-907s21c1
Sequence:CCGGGAAGGACCATGTACAGGACTTCTCGAGAAGTCCTGTACATGGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026909.2-932s21c1
Sequence:CCGGATGCAGTTGAGCAGCAGTATGCTCGAGCATACTGCTGCTCAACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026909.2-103s21c1
Sequence:CCGGCCACAGACTTCCCAAGAAAGACTCGAGTCTTTCTTGGGAAGTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026909.1-219s1c1
Sequence:CCGGGCTCCAAACACTTCGAGGAAACTCGAGTTTCCTCGAAGTGTTTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026909.1-907s1c1
Sequence:CCGGGAAGGACCATGTACAGGACTTCTCGAGAAGTCCTGTACATGGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026909.1-103s1c1
Sequence:CCGGCCACAGACTTCCCAAGAAAGACTCGAGTCTTTCTTGGGAAGTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193015    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026909.1-1029s1c1
Sequence:CCGGGCTGGCCAAATGTTACAATAACTCGAGTTATTGTAACATTTGGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks