EMAIL THIS PAGE TO A FRIEND

THAP8

THAP domain containing 8

UniProtKB ID: Q8NA92, Q0P5Z7, Q96M21
Gene ID:
Mouse(75629) THAP domain containing 8
dog(100688093) THAP domain containing 8
domestic cat(101097031) THAP domain containing 8
naked mole-rat(101712547) THAP domain containing 8
cow(537311) THAP domain containing 8
sheep(101105433) THAP domain containing 8
43 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152658 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152658 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152658 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152658 Rosetta Predictions human pricing
XM_001000510 Rosetta Predictions mouse pricing
XM_906694 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152658 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218269 predicted 1376
2 SASI_Hs02_00366549 predicted 1358
3 SASI_Hs01_00218271 predicted 1246
4 SASI_Hs01_00218273 predicted 615
5 SASI_Hs01_00218274 predicted 1000
6 SASI_Hs01_00218275 predicted 609
7 SASI_Hs02_00366550 predicted 1372
8 SASI_Hs02_00366551 predicted 1359
9 SASI_Hs01_00218276 predicted 1375
10 SASI_Hs01_00218277 predicted 1319
11 SASI_Hs01_00218270 predicted 782
12 SASI_Hs01_00218272 predicted 616
13 SASI_Hs01_00218278 predicted 1021
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001000510 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00252996 predicted 435
2 SASI_Mm01_00252997 predicted 831
3 SASI_Mm01_00252998 predicted 366
4 SASI_Mm01_00252999 predicted 919
5 SASI_Mm01_00253000 predicted 947
6 SASI_Mm01_00253001 predicted 503
7 SASI_Mm01_00253002 predicted 492
8 SASI_Mm01_00253003 predicted 423
9 SASI_Mm01_00253004 predicted 447
10 SASI_Mm01_00253005 predicted 430
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_906694 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00432677 predicted 825
2 SASI_Mm02_00432678 predicted 375
3 SASI_Mm02_00432679 predicted 916
4 SASI_Mm02_00432680 predicted 940
5 SASI_Mm02_00432681 predicted 509
6 SASI_Mm02_00432682 predicted 490
7 SASI_Mm02_00432683 predicted 635
8 SASI_Mm02_00432684 predicted 488
9 SASI_Mm02_00432685 predicted 825
10 SASI_Mm02_00432686 predicted 1114
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152658
THAP8 MISSION shRNA Bacterial Glycerol Stock
THAP domain containing 8
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152658.1-1514s1c1
Sequence:CCGGCCTAGGGATCTCTTGAACCTTCTCGAGAAGGTTCAAGAGATCCCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152658.1-618s1c1
Sequence:CCGGGAGCTTCTACAAGTTCCCACTCTCGAGAGTGGGAACTTGTAGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152658.1-612s1c1
Sequence:CCGGCCCTGTGAGCTTCTACAAGTTCTCGAGAACTTGTAGAAGCTCACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152658.1-621s1c1
Sequence:CCGGCTTCTACAAGTTCCCACTGAACTCGAGTTCAGTGGGAACTTGTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154592    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152658.1-1403s1c1
Sequence:CCGGGATAGAAGATGGAGGAGGAAACTCGAGTTTCCTCCTCCATCTTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150852    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152658.1-1660s1c1
Sequence:CCGGGAGAATCATACCTGGTTCTAACTCGAGTTAGAACCAGGTATGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152658.2-710s21c1
Sequence:CCGGGCACTTGTGCAGCGAGCACTTCTCGAGAAGTGCTCGCTGCACAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152658.2-1368s21c1
Sequence:CCGGTAAGGATCAAGACAGACAATGCTCGAGCATTGTCTGTCTTGATCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422950    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152658.2-1608s21c1
Sequence:CCGGGATCTTTGCAAATCAGTACGACTCGAGTCGTACTGATTTGCAAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152658
THAP8 MISSION shRNA shRNA Plasmid DNA
THAP domain containing 8
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152658.1-1514s1c1
Sequence:CCGGCCTAGGGATCTCTTGAACCTTCTCGAGAAGGTTCAAGAGATCCCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152658.1-618s1c1
Sequence:CCGGGAGCTTCTACAAGTTCCCACTCTCGAGAGTGGGAACTTGTAGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152658.1-612s1c1
Sequence:CCGGCCCTGTGAGCTTCTACAAGTTCTCGAGAACTTGTAGAAGCTCACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152658.1-621s1c1
Sequence:CCGGCTTCTACAAGTTCCCACTGAACTCGAGTTCAGTGGGAACTTGTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154592    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152658.1-1403s1c1
Sequence:CCGGGATAGAAGATGGAGGAGGAAACTCGAGTTTCCTCCTCCATCTTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150852    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152658.1-1660s1c1
Sequence:CCGGGAGAATCATACCTGGTTCTAACTCGAGTTAGAACCAGGTATGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152658.2-710s21c1
Sequence:CCGGGCACTTGTGCAGCGAGCACTTCTCGAGAAGTGCTCGCTGCACAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152658.2-1368s21c1
Sequence:CCGGTAAGGATCAAGACAGACAATGCTCGAGCATTGTCTGTCTTGATCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422950    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152658.2-1608s21c1
Sequence:CCGGGATCTTTGCAAATCAGTACGACTCGAGTCGTACTGATTTGCAAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152658
THAP8 MISSION shRNA Lentiviral Transduction Particles
THAP domain containing 8
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152658.1-1514s1c1
Sequence:CCGGCCTAGGGATCTCTTGAACCTTCTCGAGAAGGTTCAAGAGATCCCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152658.1-618s1c1
Sequence:CCGGGAGCTTCTACAAGTTCCCACTCTCGAGAGTGGGAACTTGTAGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152658.1-612s1c1
Sequence:CCGGCCCTGTGAGCTTCTACAAGTTCTCGAGAACTTGTAGAAGCTCACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152658.1-621s1c1
Sequence:CCGGCTTCTACAAGTTCCCACTGAACTCGAGTTCAGTGGGAACTTGTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154592    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152658.1-1403s1c1
Sequence:CCGGGATAGAAGATGGAGGAGGAAACTCGAGTTTCCTCCTCCATCTTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150852    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152658.1-1660s1c1
Sequence:CCGGGAGAATCATACCTGGTTCTAACTCGAGTTAGAACCAGGTATGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152658.2-710s21c1
Sequence:CCGGGCACTTGTGCAGCGAGCACTTCTCGAGAAGTGCTCGCTGCACAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152658.2-1368s21c1
Sequence:CCGGTAAGGATCAAGACAGACAATGCTCGAGCATTGTCTGTCTTGATCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422950    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152658.2-1608s21c1
Sequence:CCGGGATCTTTGCAAATCAGTACGACTCGAGTCGTACTGATTTGCAAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks